diff -Nru fastqc-0.11.9+dfsg/debian/changelog fastqc-0.11.9+dfsg/debian/changelog
--- fastqc-0.11.9+dfsg/debian/changelog	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/changelog	2020-04-06 22:26:31.000000000 +0000
@@ -1,3 +1,16 @@
+fastqc (0.11.9+dfsg-3) unstable; urgency=medium
+
+  [ tony mancill ]
+  * Team upload.
+  * Update autopkgtests to compare summary output (Closes: #950311)
+
+  [ Andreas Tille ]
+  * Add salsa-ci file (routine-update)
+  * Rules-Requires-Root: no (routine-update)
+  * Set upstream metadata fields: Repository, Repository-Browse.
+
+ -- tony mancill <tmancill@debian.org>  Mon, 06 Apr 2020 15:26:31 -0700
+
 fastqc (0.11.9+dfsg-2) unstable; urgency=medium
 
   * Fix and enhance autopkgtest
diff -Nru fastqc-0.11.9+dfsg/debian/control fastqc-0.11.9+dfsg/debian/control
--- fastqc-0.11.9+dfsg/debian/control	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/control	2020-04-06 22:26:31.000000000 +0000
@@ -16,6 +16,7 @@
 Vcs-Browser: https://salsa.debian.org/med-team/fastqc
 Vcs-Git: https://salsa.debian.org/med-team/fastqc.git
 Homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
+Rules-Requires-Root: no
 
 Package: fastqc
 Architecture: all
diff -Nru fastqc-0.11.9+dfsg/debian/salsa-ci.yml fastqc-0.11.9+dfsg/debian/salsa-ci.yml
--- fastqc-0.11.9+dfsg/debian/salsa-ci.yml	1970-01-01 00:00:00.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/salsa-ci.yml	2020-04-06 22:26:31.000000000 +0000
@@ -0,0 +1,4 @@
+---
+include:
+  - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/salsa-ci.yml
+  - https://salsa.debian.org/salsa-ci-team/pipeline/raw/master/pipeline-jobs.yml
diff -Nru fastqc-0.11.9+dfsg/debian/source/include-binaries fastqc-0.11.9+dfsg/debian/source/include-binaries
--- fastqc-0.11.9+dfsg/debian/source/include-binaries	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/source/include-binaries	2020-04-06 22:26:31.000000000 +0000
@@ -1 +1 @@
-debian/tests.fastqc/toy.bam
+debian/tests.fastqc/toy_bam.bam
diff -Nru fastqc-0.11.9+dfsg/debian/tests/example_fastqc_expected_summary.txt fastqc-0.11.9+dfsg/debian/tests/example_fastqc_expected_summary.txt
--- fastqc-0.11.9+dfsg/debian/tests/example_fastqc_expected_summary.txt	1970-01-01 00:00:00.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests/example_fastqc_expected_summary.txt	2020-04-06 22:26:31.000000000 +0000
@@ -0,0 +1,11 @@
+PASS	Basic Statistics	example.fastq
+WARN	Per base sequence quality	example.fastq
+PASS	Per tile sequence quality	example.fastq
+PASS	Per sequence quality scores	example.fastq
+WARN	Per base sequence content	example.fastq
+WARN	Per sequence GC content	example.fastq
+PASS	Per base N content	example.fastq
+PASS	Sequence Length Distribution	example.fastq
+PASS	Sequence Duplication Levels	example.fastq
+WARN	Overrepresented sequences	example.fastq
+PASS	Adapter Content	example.fastq
diff -Nru fastqc-0.11.9+dfsg/debian/tests/run-unit-test fastqc-0.11.9+dfsg/debian/tests/run-unit-test
--- fastqc-0.11.9+dfsg/debian/tests/run-unit-test	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests/run-unit-test	2020-04-06 22:26:31.000000000 +0000
@@ -2,6 +2,8 @@
 set -e
 
 pkg="fastqc"
+tests_dir="$PWD/debian/tests"
+test_failures=0
 
 if [ "$AUTOPKGTEST_TMP" = "" ] ; then
   AUTOPKGTEST_TMP=`mktemp -d /tmp/${pkg}-test.XXXXXX`
@@ -14,26 +16,28 @@
 
 find . -name "*.gz" -exec gunzip \{\} \;
 
-for sample in example.fastq toy.sam toy.bam ; do
-    /usr/bin/fastqc "$sample"
-    if [ "$sample" = "example.fastq" ] ; then
-        result=example_fastqc
-    else
-        result=toy_fastqc
-    fi
-    unzip -q "$result".zip
-    if grep -q FAIL "$result"/summary.txt ; then
+for sample in example.fastq toy_sam.sam toy_bam.bam ; do
+    /usr/bin/fastqc --extract "$sample"
+    result="${sample%%.*}_fastqc"
+    expected="${tests_dir}/${result}_expected_summary.txt"
+    if ! diff -q "${result}/summary.txt" ${expected} 2>/dev/null ; then
+	(( test_failures += 1 ))
         cat <<EOT
-There were some failures logged in summary of
+Summary results did not match contents of ${expected} for
     fastqc "$sample"
 Please investigate!
 EOT
-        grep FAIL "$result"/summary.txt
     else
-        echo "All passing in:  fastqc "$sample" "
+        echo "Summary results match for:  fastqc "$sample" "
     fi
     rm -rf "$result"*
     echo ""
 done
 
-echo "PASS"
+if (( test_failures == 0 )); then
+    echo "PASS"
+    exit 0
+fi
+
+echo "FAIL mismatched fastqc summary count: $test_failures"
+exit 1
diff -Nru fastqc-0.11.9+dfsg/debian/tests/toy_bam_fastqc_expected_summary.txt fastqc-0.11.9+dfsg/debian/tests/toy_bam_fastqc_expected_summary.txt
--- fastqc-0.11.9+dfsg/debian/tests/toy_bam_fastqc_expected_summary.txt	1970-01-01 00:00:00.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests/toy_bam_fastqc_expected_summary.txt	2020-04-06 22:26:31.000000000 +0000
@@ -0,0 +1,10 @@
+PASS	Basic Statistics	toy_bam.bam
+PASS	Per base sequence quality	toy_bam.bam
+FAIL	Per sequence quality scores	toy_bam.bam
+FAIL	Per base sequence content	toy_bam.bam
+FAIL	Per sequence GC content	toy_bam.bam
+PASS	Per base N content	toy_bam.bam
+WARN	Sequence Length Distribution	toy_bam.bam
+PASS	Sequence Duplication Levels	toy_bam.bam
+FAIL	Overrepresented sequences	toy_bam.bam
+PASS	Adapter Content	toy_bam.bam
diff -Nru fastqc-0.11.9+dfsg/debian/tests/toy_sam_fastqc_expected_summary.txt fastqc-0.11.9+dfsg/debian/tests/toy_sam_fastqc_expected_summary.txt
--- fastqc-0.11.9+dfsg/debian/tests/toy_sam_fastqc_expected_summary.txt	1970-01-01 00:00:00.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests/toy_sam_fastqc_expected_summary.txt	2020-04-06 22:26:31.000000000 +0000
@@ -0,0 +1,10 @@
+PASS	Basic Statistics	toy_sam.sam
+PASS	Per base sequence quality	toy_sam.sam
+FAIL	Per sequence quality scores	toy_sam.sam
+FAIL	Per base sequence content	toy_sam.sam
+FAIL	Per sequence GC content	toy_sam.sam
+PASS	Per base N content	toy_sam.sam
+WARN	Sequence Length Distribution	toy_sam.sam
+PASS	Sequence Duplication Levels	toy_sam.sam
+FAIL	Overrepresented sequences	toy_sam.sam
+PASS	Adapter Content	toy_sam.sam
Binary files /tmp/tmpXcfYo6/DK1WTjmdUV/fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.bam and /tmp/tmpXcfYo6/758uenmSrA/fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.bam differ
Binary files /tmp/tmpXcfYo6/DK1WTjmdUV/fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_bam.bam and /tmp/tmpXcfYo6/758uenmSrA/fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_bam.bam differ
diff -Nru fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.sam fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.sam
--- fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.sam	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests.fastqc/toy.sam	1970-01-01 00:00:00.000000000 +0000
@@ -1,14 +0,0 @@
-@SQ	SN:ref	LN:45
-@SQ	SN:ref2	LN:40
-r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
-r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
-r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
-r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
-r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
-r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
-x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
-x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
-x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
-x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
-x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
-x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????
diff -Nru fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_sam.sam fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_sam.sam
--- fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_sam.sam	1970-01-01 00:00:00.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/tests.fastqc/toy_sam.sam	2020-04-06 22:26:31.000000000 +0000
@@ -0,0 +1,14 @@
+@SQ	SN:ref	LN:45
+@SQ	SN:ref2	LN:40
+r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
+r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
+r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
+r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
+r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
+r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
+x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
+x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
+x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
+x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
+x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
+x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????
diff -Nru fastqc-0.11.9+dfsg/debian/upstream/metadata fastqc-0.11.9+dfsg/debian/upstream/metadata
--- fastqc-0.11.9+dfsg/debian/upstream/metadata	2020-01-31 10:24:32.000000000 +0000
+++ fastqc-0.11.9+dfsg/debian/upstream/metadata	2020-04-06 22:26:31.000000000 +0000
@@ -10,3 +10,5 @@
    Entry: SCR_014583
  - Name: conda:bioconda
    Entry: fastqc
+Repository: https://github.com/s-andrews/FastQC.git
+Repository-Browse: https://github.com/s-andrews/FastQC