diff -Nru mummer-3.23+dfsg/debian/changelog mummer-3.23+dfsg/debian/changelog --- mummer-3.23+dfsg/debian/changelog 2020-04-15 06:37:33.000000000 +0000 +++ mummer-3.23+dfsg/debian/changelog 2020-07-23 18:31:54.000000000 +0000 @@ -1,3 +1,15 @@ +mummer (3.23+dfsg-6) unstable; urgency=medium + + [ Étienne Mollier ] + * Team upload. + * Removed dependency to C-Shell. + + [ Andreas Tille ] + * Remove csh from docs + * debhelper-compat (= 13) + + -- Étienne Mollier Thu, 23 Jul 2020 20:31:54 +0200 + mummer (3.23+dfsg-5) unstable; urgency=medium [ Charles Plessy ] diff -Nru mummer-3.23+dfsg/debian/control mummer-3.23+dfsg/debian/control --- mummer-3.23+dfsg/debian/control 2020-04-15 06:37:33.000000000 +0000 +++ mummer-3.23+dfsg/debian/control 2020-07-23 18:31:54.000000000 +0000 @@ -5,11 +5,10 @@ Charles Plessy Section: science Priority: optional -Build-Depends: debhelper-compat (= 12), +Build-Depends: debhelper-compat (= 13), texlive-latex-base, texlive-latex-recommended, texlive-fonts-recommended, - csh | c-shell Standards-Version: 4.5.0 Vcs-Browser: https://salsa.debian.org/med-team/mummer Vcs-Git: https://salsa.debian.org/med-team/mummer.git diff -Nru mummer-3.23+dfsg/debian/mummer.docs mummer-3.23+dfsg/debian/mummer.docs --- mummer-3.23+dfsg/debian/mummer.docs 2020-04-15 06:37:33.000000000 +0000 +++ mummer-3.23+dfsg/debian/mummer.docs 2020-07-23 18:31:54.000000000 +0000 @@ -1,3 +1,3 @@ README ACKNOWLEDGEMENTS -debian/NEWS.Debian +debian/NEWS diff -Nru mummer-3.23+dfsg/debian/NEWS mummer-3.23+dfsg/debian/NEWS --- mummer-3.23+dfsg/debian/NEWS 1970-01-01 00:00:00.000000000 +0000 +++ mummer-3.23+dfsg/debian/NEWS 2020-07-23 18:31:54.000000000 +0000 @@ -0,0 +1,11 @@ +mummer (3.23~dfsg-3) unstable; urgency=medium + + This version of mummer contains two patches which are fetched from an old + code copy of mummer version 3.20 which is shipped with mugsy (to be + packaged). It adds the tools delta2blocks and delta2maf as well as an + additional option to mummer's delta-filter tool -b for reporting + duplications. + + Please check your results thoroughly to avoid any side effects. + + -- Andreas Tille Mon, 13 Apr 2015 22:29:27 +0200 diff -Nru mummer-3.23+dfsg/debian/NEWS.Debian mummer-3.23+dfsg/debian/NEWS.Debian --- mummer-3.23+dfsg/debian/NEWS.Debian 2020-04-15 06:37:33.000000000 +0000 +++ mummer-3.23+dfsg/debian/NEWS.Debian 1970-01-01 00:00:00.000000000 +0000 @@ -1,11 +0,0 @@ -mummer (3.23~dfsg-3) unstable; urgency=medium - - This version of mummer contains two patches which are fetched from an old - code copy of mummer version 3.20 which is shipped with mugsy (to be - packaged). It adds the tools delta2blocks and delta2maf as well as an - additional option to mummer's delta-filter tool -b for reporting - duplications. - - Please check your results thoroughly to avoid any side effects. - - -- Andreas Tille Mon, 13 Apr 2015 22:29:27 +0200 diff -Nru mummer-3.23+dfsg/debian/patches/remove-csh-dependency.patch mummer-3.23+dfsg/debian/patches/remove-csh-dependency.patch --- mummer-3.23+dfsg/debian/patches/remove-csh-dependency.patch 1970-01-01 00:00:00.000000000 +0000 +++ mummer-3.23+dfsg/debian/patches/remove-csh-dependency.patch 2020-07-23 18:31:54.000000000 +0000 @@ -0,0 +1,39 @@ +Description: remove checks for csh + While the package can safely be built without csh, there are still a few + checks that are causing various error messages at build time. This patch + removes them. +Author: Étienne Mollier +Forwarded: no +Last-Update: 2020-07-23 +--- +This patch header follows DEP-3: http://dep.debian.net/deps/dep3/ +--- mummer.orig/Makefile ++++ mummer/Makefile +@@ -38,7 +38,6 @@ + CC := $(filter /%,$(shell /bin/sh -c 'type gcc')) + CXX := $(filter /%,$(shell /bin/sh -c 'type g++')) + SED := $(filter /%,$(shell /bin/sh -c 'type sed')) +-CSH := $(filter /%,$(shell /bin/sh -c 'type csh')) + PERL := $(filter /%,$(shell /bin/sh -c 'type perl')) + AR := $(filter /%,$(shell /bin/sh -c 'type ar')) + +@@ -76,9 +75,6 @@ + ifndef SED + @echo "ERROR: 'sed' StreamEDitor not found" + endif +-ifndef CSH +- @echo "ERROR: 'csh' C-shell not found" +-endif + ifndef PERL + @echo "ERROR: 'perl' PERL not found" + endif +--- mummer.orig/scripts/Makefile ++++ mummer/scripts/Makefile +@@ -18,7 +18,6 @@ + endif + + SED := $(filter /%,$(shell /bin/sh -c 'type sed')) +-CSH := $(filter /%,$(shell /bin/sh -c 'type csh')) + PERL := $(filter /%,$(shell /bin/sh -c 'type perl')) + VPATH := $(BIN_DIR) + diff -Nru mummer-3.23+dfsg/debian/patches/remove-csh-from-doc.patch mummer-3.23+dfsg/debian/patches/remove-csh-from-doc.patch --- mummer-3.23+dfsg/debian/patches/remove-csh-from-doc.patch 1970-01-01 00:00:00.000000000 +0000 +++ mummer-3.23+dfsg/debian/patches/remove-csh-from-doc.patch 2020-07-23 18:31:54.000000000 +0000 @@ -0,0 +1,96 @@ +Author: Andreas Tille +Description: Remove csh from docs +Last-Update: Thu, 23 Jul 2020 20:31:54 +0200 + +--- a/README ++++ b/README +@@ -68,7 +68,7 @@ format (qry.seq) type the following at t + + or + +- './run-mummer3.csh ref.seq qry.seq ' ++ './run-mummer3 ref.seq qry.seq ' + + To produce the following files: + .out +--- a/docs/run-mummer1.README ++++ b/docs/run-mummer1.README +@@ -38,10 +38,10 @@ it crashes for that reason, that's not a + required. + + To use this system, first compile it by typing 'make' at the +-command line. There is a script, 'run-mummer1.csh', that runs all ++command line. There is a script, 'run-mummer1', that runs all + the steps of aligning two genomes. The script takes these arguments: + +- run-mummer1.csh [-r] ++ run-mummer1 [-r] + + The two genomes must DNA sequences in FASTA format. Multi-FASTA + files don't work. The tag is used to create 4 output files, +@@ -60,7 +60,7 @@ not performed. + + IMPORTANT: the performance of the program can critically depend on the + minimum MUM length you use. The default is 20bp. If you want to +-change it, do the following: edit the file run-mummer1.csh. Add a new ++change it, do the following: edit the file run-mummer1. Add a new + length switch to the 'mummer' call. + + The other file - one that we often spend lots of time analyzing - is +@@ -90,8 +90,8 @@ Files in this directory: + gaps.cc Finds longest consistent set of matches in list + produced by mummer1 program. + +- run-mummer1.csh Script to run alignment programs. Format is: +- run-mummer1.csh [-flip] ++ run-mummer1 Script to run alignment programs. Format is: ++ run-mummer1 [-flip] + will be used to make output files: .out , .gaps + and .align . -r will reverse complement + +--- a/docs/web/manual/index.html ++++ b/docs/web/manual/index.html +@@ -516,7 +516,6 @@ td { +
  • make (GNU make 3.79.1)
    • +
  • perl (PERL 5.6.0)
    • +
  • sh   (GNU sh 1.14.7)
    • +-
  • csh  (tcsh 6.10.00)
    • +
  • g++  (GNU gcc 2.95.3)
    • +
  • sed  (GNU sed 3.02)
    • +
  • awk  (GNU awk 3.0.4)
    • +@@ -647,7 +646,7 @@ td { + can also be viewed with the same utility programs (see above). Refer to the + PROmer section for a list of options and output descriptions.

    +
    run-mummer1 and run-mummer3
    +-

    run-mummer1 and run-mummer3 are cshell script pipelines ++

    run-mummer1 and run-mummer3 are shell script pipelines + for the general alignment of two sequences. They follow the same three steps + of NUCmer and PROmer, in that they match, cluster and extend, however they handle + any input sequence, not just nucleotide. This non-discrimination can be useful, +@@ -1192,7 +1191,7 @@ Long Exact Matches: + repeat positions are denoted by an 'r' following the Start2 position, + and are relative to the forward strand of the sequence.

    +

    5.1.3. exact-tandems

    +-

    exact-tandems is a wrapper cshell script for the repeat-match ++

    exact-tandems is a wrapper shell script for the repeat-match + program. It provides a list of exact tandem repeats within a single input sequence.

    +
    Command line syntax
    +

    exact-tandems <sequence file> <min length>

    +@@ -1910,7 +1909,7 @@ PROMER + and the reverse strand of the query.

    +
    Program options
    +

    There are no available command line options for run-mummer1. Instead, +- the user must directly edit the csh script to alter the command ++ the user must directly edit the sh script to alter the command + line values passed to the individual pipeline programs. The only available tweak + is changing the minimum match length value for mummer, set with + the -l option within the script. Decreasing this value may increase +@@ -2008,7 +2007,7 @@ S: tagctgtcggggcgatcccctcggtagtga + requires hand editing the script.

    +
    Program options
    +

    There are no available command line options for run-mummer3. Instead, +- the user must directly edit the csh script to alter the command ++ the user must directly edit the sh script to alter the command + line values passed to the individual pipeline programs. Altering these parameters + is suggested for most applications, as the default values may not always produce + the best output. Parameter values may be added or changed for mummer, diff -Nru mummer-3.23+dfsg/debian/patches/series mummer-3.23+dfsg/debian/patches/series --- mummer-3.23+dfsg/debian/patches/series 2020-04-15 06:37:33.000000000 +0000 +++ mummer-3.23+dfsg/debian/patches/series 2020-07-23 18:31:54.000000000 +0000 @@ -9,3 +9,5 @@ # most probably broken see bug #843621 # addition_from_report_duplicates.patch mummerplot.patch +remove-csh-dependency.patch +remove-csh-from-doc.patch