https://launchpad.net/ubuntu/+archive/test-rebuild-20210927-impish/+build/22120063 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux lgw01-amd64-046 4.15.0-158-generic #166-Ubuntu SMP Fri Sep 17 19:37:52 UTC 2021 x86_64 Buildd toolchain package versions: launchpad-buildd_202~502~ubuntu18.04.1 python3-lpbuildd_202~502~ubuntu18.04.1 sbuild_0.75.0-1ubuntu1 bzr-builder_0.7.3+bzr174~ppa13~ubuntu16.04.1 bzr_2.7.0+bzr6622-10 git-build-recipe_0.3.6~git201906051340.ff11471~ubuntu18.04.1 git_1:2.17.1-1ubuntu0.9 dpkg-dev_1.19.0.5ubuntu2.3 python-debian_0.1.32 python3-debian_0.1.32. Syncing the system clock with the buildd NTP service... 29 Sep 04:13:17 ntpdate[1799]: adjust time server 10.211.37.1 offset -0.000944 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 --image-type chroot /home/buildd/filecache-default/470b94eb81e7101f5c7afd2cf17d7483b3ea9d4e Creating target for build PACKAGEBUILD-22120063 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 Starting target for build PACKAGEBUILD-22120063 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 'deb http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish main' 'deb http://ftpmaster.internal/ubuntu impish main universe' Overriding sources.list in build-PACKAGEBUILD-22120063 RUN: /usr/share/launchpad-buildd/bin/in-target add-trusted-keys --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 Adding trusted keys to build-PACKAGEBUILD-22120063 Warning: apt-key is deprecated. Manage keyring files in trusted.gpg.d instead (see apt-key(8)). OK Warning: apt-key is deprecated. Manage keyring files in trusted.gpg.d instead (see apt-key(8)). /etc/apt/trusted.gpg -------------------- pub rsa1024 2009-10-22 [SC] 60C3 1780 3A41 BA51 845E 371A 1E93 77A2 BA9E F27F uid [ unknown] Launchpad Toolchain builds /etc/apt/trusted.gpg.d/ubuntu-keyring-2012-cdimage.gpg ------------------------------------------------------ pub rsa4096 2012-05-11 [SC] 8439 38DF 228D 22F7 B374 2BC0 D94A A3F0 EFE2 1092 uid [ unknown] Ubuntu CD Image Automatic Signing Key (2012) /etc/apt/trusted.gpg.d/ubuntu-keyring-2018-archive.gpg ------------------------------------------------------ pub rsa4096 2018-09-17 [SC] F6EC B376 2474 EDA9 D21B 7022 8719 20D1 991B C93C uid [ unknown] Ubuntu Archive Automatic Signing Key (2018) RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 Updating target for build PACKAGEBUILD-22120063 Get:1 http://ftpmaster.internal/ubuntu impish InRelease [269 kB] Get:2 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish InRelease [17.5 kB] Get:3 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 Packages [22.5 kB] Get:4 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main Translation-en [10.5 kB] Get:5 http://ftpmaster.internal/ubuntu impish/main amd64 Packages [1407 kB] Get:6 http://ftpmaster.internal/ubuntu impish/main Translation-en [513 kB] Get:7 http://ftpmaster.internal/ubuntu impish/universe amd64 Packages [13.1 MB] Get:8 http://ftpmaster.internal/ubuntu impish/universe Translation-en [5459 kB] Fetched 20.8 MB in 7s (2986 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages were automatically installed and are no longer required: g++-10 libstdc++-10-dev Use 'sudo apt autoremove' to remove them. The following packages will be REMOVED: libffi8ubuntu1* The following NEW packages will be installed: cpp-11 g++-11 gcc-11 libexpat1 libffi8 libgcc-11-dev libmpdec3 libpython3-stdlib libpython3.9-minimal libpython3.9-stdlib libstdc++-11-dev media-types python3 python3-minimal python3-psutil python3.9 python3.9-minimal The following packages will be upgraded: advancecomp apt base-files base-passwd bash binutils binutils-common binutils-x86-64-linux-gnu bsdutils build-essential cpp cpp-10 dash debconf diffutils dpkg dpkg-dev e2fsprogs findutils g++ g++-10 gcc gcc-10 gcc-10-base gcc-11-base gpg gpg-agent gpgconf gpgv grep gzip libapparmor1 libapt-pkg6.0 libasan6 libassuan0 libatomic1 libaudit-common libaudit1 libbinutils libblkid1 libc-bin libc-dev-bin libc6 libc6-dev libcc1-0 libcom-err2 libcrypt-dev libcrypt1 libcryptsetup12 libctf-nobfd0 libctf0 libdb5.3 libdevmapper1.02.1 libdpkg-perl libext2fs2 libgcc-10-dev libgcc-s1 libgcrypt20 libgnutls30 libgomp1 libgssapi-krb5-2 libhogweed6 libidn2-0 libisl23 libitm1 libk5crypto3 libkmod2 libkrb5-3 libkrb5support0 liblsan0 liblz4-1 liblzma5 libmount1 libnettle8 libnsl-dev libnsl2 libp11-kit0 libpam-modules libpam-modules-bin libpam-runtime libpam0g libpcre2-8-0 libperl5.32 libprocps8 libquadmath0 libreadline8 libsmartcols1 libsqlite3-0 libss2 libssl1.1 libstdc++-10-dev libstdc++6 libsystemd0 libtirpc-common libtirpc-dev libtirpc3 libtsan0 libubsan1 libudev1 libunistring2 libuuid1 libzstd1 linux-libc-dev login logsave lto-disabled-list mount openssl passwd perl perl-base perl-modules-5.32 pinentry-curses pkgbinarymangler procps readline-common systemd systemd-sysv systemd-timesyncd sysvinit-utils usrmerge util-linux xz-utils zlib1g 124 upgraded, 17 newly installed, 1 to remove and 0 not upgraded. Need to get 272 MB of archives. After this operation, 516 MB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu impish/main amd64 libcrypt-dev amd64 1:4.4.18-4ubuntu1 [104 kB] Get:2 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 dpkg amd64 1.20.9ubuntu13 [1265 kB] Get:3 http://ftpmaster.internal/ubuntu impish/main amd64 libnsl-dev amd64 1.3.0-2 [66.2 kB] Get:4 http://ftpmaster.internal/ubuntu impish/main amd64 libc6-dev amd64 2.34-0ubuntu2 [1886 kB] Get:5 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 g++ amd64 4:11.2.0-1ubuntu1 [1412 B] Get:6 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 gcc amd64 4:11.2.0-1ubuntu1 [5112 B] Get:7 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 cpp amd64 4:11.2.0-1ubuntu1 [27.7 kB] Get:8 http://ftpmaster.internal/ubuntu impish/main amd64 libc-dev-bin amd64 2.34-0ubuntu2 [20.3 kB] Get:9 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 dpkg-dev all 1.20.9ubuntu13 [938 kB] Get:10 http://ftpmaster.internal/ubuntu impish/main amd64 libcrypt1 amd64 1:4.4.18-4ubuntu1 [75.6 kB] Get:11 http://ftpmaster.internal/ubuntu impish/main amd64 libtirpc-common all 1.3.2-2 [7674 B] Get:12 http://ftpmaster.internal/ubuntu impish/main amd64 libtirpc-dev amd64 1.3.2-2 [192 kB] Get:13 http://ftpmaster.internal/ubuntu impish/main amd64 libk5crypto3 amd64 1.18.3-6 [85.2 kB] Get:14 http://ftpmaster.internal/ubuntu impish/main amd64 libkrb5support0 amd64 1.18.3-6 [32.1 kB] Get:15 http://ftpmaster.internal/ubuntu impish/main amd64 libkrb5-3 amd64 1.18.3-6 [354 kB] Get:16 http://ppa.launchpad.net/ubuntu-toolchain-r/volatile/ubuntu impish/main amd64 libdpkg-perl all 1.20.9ubuntu13 [235 kB] Get:17 http://ftpmaster.internal/ubuntu impish/main amd64 libgssapi-krb5-2 amd64 1.18.3-6 [143 kB] Get:18 http://ftpmaster.internal/ubuntu impish/main amd64 libcom-err2 amd64 1.46.3-1ubuntu3 [10.7 kB] Get:19 http://ftpmaster.internal/ubuntu impish/main amd64 libperl5.32 amd64 5.32.1-3ubuntu3 [4713 kB] Get:20 http://ftpmaster.internal/ubuntu impish/main amd64 perl amd64 5.32.1-3ubuntu3 [227 kB] Get:21 http://ftpmaster.internal/ubuntu impish/main amd64 perl-base amd64 5.32.1-3ubuntu3 [1745 kB] Get:22 http://ftpmaster.internal/ubuntu impish/main amd64 perl-modules-5.32 all 5.32.1-3ubuntu3 [2945 kB] Get:23 http://ftpmaster.internal/ubuntu impish/main amd64 libdb5.3 amd64 5.3.28+dfsg1-0.8ubuntu1 [673 kB] Get:24 http://ftpmaster.internal/ubuntu impish/main amd64 zlib1g amd64 1:1.2.11.dfsg-2ubuntu7 [58.1 kB] Get:25 http://ftpmaster.internal/ubuntu impish/main amd64 debconf all 1.5.77 [121 kB] Get:26 http://ftpmaster.internal/ubuntu impish/main amd64 libc6 amd64 2.34-0ubuntu2 [3028 kB] Get:27 http://ftpmaster.internal/ubuntu impish/main amd64 libc-bin amd64 2.34-0ubuntu2 [1023 kB] Get:28 http://ftpmaster.internal/ubuntu impish/main amd64 libssl1.1 amd64 1.1.1l-1ubuntu1 [1446 kB] Get:29 http://ftpmaster.internal/ubuntu impish/main amd64 libtirpc3 amd64 1.3.2-2 [81.5 kB] Get:30 http://ftpmaster.internal/ubuntu impish/main amd64 libnsl2 amd64 1.3.0-2 [39.0 kB] Get:31 http://ftpmaster.internal/ubuntu impish/main amd64 linux-libc-dev amd64 5.13.0-16.16 [1275 kB] Get:32 http://ftpmaster.internal/ubuntu impish/main amd64 libasan6 amd64 11.2.0-7ubuntu2 [2280 kB] Get:33 http://ftpmaster.internal/ubuntu impish/main amd64 libubsan1 amd64 11.2.0-7ubuntu2 [920 kB] Get:34 http://ftpmaster.internal/ubuntu impish/main amd64 libtsan0 amd64 11.2.0-7ubuntu2 [2259 kB] Get:35 http://ftpmaster.internal/ubuntu impish/main amd64 libquadmath0 amd64 11.2.0-7ubuntu2 [154 kB] Get:36 http://ftpmaster.internal/ubuntu impish/main amd64 liblsan0 amd64 11.2.0-7ubuntu2 [974 kB] Get:37 http://ftpmaster.internal/ubuntu impish/main amd64 libitm1 amd64 11.2.0-7ubuntu2 [30.0 kB] Get:38 http://ftpmaster.internal/ubuntu impish/main amd64 libgomp1 amd64 11.2.0-7ubuntu2 [117 kB] Get:39 http://ftpmaster.internal/ubuntu impish/main amd64 gcc-11-base amd64 11.2.0-7ubuntu2 [20.5 kB] Get:40 http://ftpmaster.internal/ubuntu impish/main amd64 libgcc-s1 amd64 11.2.0-7ubuntu2 [45.6 kB] Get:41 http://ftpmaster.internal/ubuntu impish/main amd64 libcc1-0 amd64 11.2.0-7ubuntu2 [53.9 kB] Get:42 http://ftpmaster.internal/ubuntu impish/main amd64 libatomic1 amd64 11.2.0-7ubuntu2 [10.0 kB] Get:43 http://ftpmaster.internal/ubuntu impish/main amd64 libstdc++6 amd64 11.2.0-7ubuntu2 [656 kB] Get:44 http://ftpmaster.internal/ubuntu impish/main amd64 base-files amd64 11.1ubuntu3 [60.9 kB] Get:45 http://ftpmaster.internal/ubuntu impish/main amd64 bash amd64 5.1-3ubuntu1 [731 kB] Get:46 http://ftpmaster.internal/ubuntu impish/main amd64 bsdutils amd64 1:2.36.1-8ubuntu1 [83.1 kB] Get:47 http://ftpmaster.internal/ubuntu impish/main amd64 dash amd64 0.5.11+git20210120+802ebd4-1 [87.3 kB] Get:48 http://ftpmaster.internal/ubuntu impish/main amd64 diffutils amd64 1:3.8-0ubuntu1 [205 kB] Get:49 http://ftpmaster.internal/ubuntu impish/main amd64 findutils amd64 4.8.0-1ubuntu2 [332 kB] Get:50 http://ftpmaster.internal/ubuntu impish/main amd64 grep amd64 3.7-0ubuntu1 [195 kB] Get:51 http://ftpmaster.internal/ubuntu impish/main amd64 gzip amd64 1.10-4ubuntu1 [92.9 kB] Get:52 http://ftpmaster.internal/ubuntu impish/main amd64 login amd64 1:4.8.1-1ubuntu9 [222 kB] Get:53 http://ftpmaster.internal/ubuntu impish/main amd64 util-linux amd64 2.36.1-8ubuntu1 [1016 kB] Get:54 http://ftpmaster.internal/ubuntu impish/main amd64 base-passwd amd64 3.5.51 [48.5 kB] Get:55 http://ftpmaster.internal/ubuntu impish/main amd64 sysvinit-utils amd64 2.96-7ubuntu1 [20.1 kB] Get:56 http://ftpmaster.internal/ubuntu impish/main amd64 libgcrypt20 amd64 1.8.7-5ubuntu2 [468 kB] Get:57 http://ftpmaster.internal/ubuntu impish/main amd64 liblz4-1 amd64 1.9.3-2 [52.9 kB] Get:58 http://ftpmaster.internal/ubuntu impish/main amd64 liblzma5 amd64 5.2.5-2 [96.5 kB] Get:59 http://ftpmaster.internal/ubuntu impish/main amd64 systemd-sysv amd64 248.3-1ubuntu7 [10.5 kB] Get:60 http://ftpmaster.internal/ubuntu impish/main amd64 systemd-timesyncd amd64 248.3-1ubuntu7 [30.8 kB] Get:61 http://ftpmaster.internal/ubuntu impish/main amd64 libapparmor1 amd64 3.0.3-0ubuntu1 [38.4 kB] Get:62 http://ftpmaster.internal/ubuntu impish/main amd64 libaudit-common all 1:3.0-2ubuntu2 [4788 B] Get:63 http://ftpmaster.internal/ubuntu impish/main amd64 libaudit1 amd64 1:3.0-2ubuntu2 [39.8 kB] Get:64 http://ftpmaster.internal/ubuntu impish/main amd64 libblkid1 amd64 2.36.1-8ubuntu1 [97.7 kB] Get:65 http://ftpmaster.internal/ubuntu impish/main amd64 libudev1 amd64 248.3-1ubuntu7 [76.0 kB] Get:66 http://ftpmaster.internal/ubuntu impish/main amd64 libdevmapper1.02.1 amd64 2:1.02.175-2.1ubuntu1 [128 kB] Get:67 http://ftpmaster.internal/ubuntu impish/main amd64 libuuid1 amd64 2.36.1-8ubuntu1 [23.3 kB] Get:68 http://ftpmaster.internal/ubuntu impish/main amd64 libcryptsetup12 amd64 2:2.3.6-0ubuntu1 [213 kB] Get:69 http://ftpmaster.internal/ubuntu impish/main amd64 libnettle8 amd64 3.7.3-1 [147 kB] Get:70 http://ftpmaster.internal/ubuntu impish/main amd64 libhogweed6 amd64 3.7.3-1 [195 kB] Get:71 http://ftpmaster.internal/ubuntu impish/main amd64 libunistring2 amd64 0.9.10-6 [503 kB] Get:72 http://ftpmaster.internal/ubuntu impish/main amd64 libidn2-0 amd64 2.3.1-1 [49.8 kB] Get:73 http://ftpmaster.internal/ubuntu impish/main amd64 libffi8 amd64 3.4.2-1ubuntu5 [21.8 kB] Get:74 http://ftpmaster.internal/ubuntu impish/main amd64 libp11-kit0 amd64 0.23.22-1build1 [254 kB] Get:75 http://ftpmaster.internal/ubuntu impish/main amd64 libgnutls30 amd64 3.7.1-5ubuntu1 [956 kB] Get:76 http://ftpmaster.internal/ubuntu impish/main amd64 libzstd1 amd64 1.4.8+dfsg-2.1 [290 kB] Get:77 http://ftpmaster.internal/ubuntu impish/main amd64 libkmod2 amd64 28-1ubuntu4 [45.0 kB] Get:78 http://ftpmaster.internal/ubuntu impish/main amd64 libmount1 amd64 2.36.1-8ubuntu1 [116 kB] Get:79 http://ftpmaster.internal/ubuntu impish/main amd64 libpam0g amd64 1.3.1-5ubuntu11 [58.4 kB] Get:80 http://ftpmaster.internal/ubuntu impish/main amd64 mount amd64 2.36.1-8ubuntu1 [110 kB] Get:81 http://ftpmaster.internal/ubuntu impish/main amd64 systemd amd64 248.3-1ubuntu7 [4402 kB] Get:82 http://ftpmaster.internal/ubuntu impish/main amd64 libsystemd0 amd64 248.3-1ubuntu7 [306 kB] Get:83 http://ftpmaster.internal/ubuntu impish/main amd64 libapt-pkg6.0 amd64 2.3.9 [900 kB] Get:84 http://ftpmaster.internal/ubuntu impish/main amd64 gpgv amd64 2.2.20-1ubuntu4 [130 kB] Get:85 http://ftpmaster.internal/ubuntu impish/main amd64 apt amd64 2.3.9 [1382 kB] Get:86 http://ftpmaster.internal/ubuntu impish/main amd64 libpam-modules-bin amd64 1.3.1-5ubuntu11 [41.2 kB] Get:87 http://ftpmaster.internal/ubuntu impish/main amd64 libpam-modules amd64 1.3.1-5ubuntu11 [272 kB] Get:88 http://ftpmaster.internal/ubuntu impish/main amd64 logsave amd64 1.46.3-1ubuntu3 [11.5 kB] Get:89 http://ftpmaster.internal/ubuntu impish/main amd64 libext2fs2 amd64 1.46.3-1ubuntu3 [210 kB] Get:90 http://ftpmaster.internal/ubuntu impish/main amd64 e2fsprogs amd64 1.46.3-1ubuntu3 [588 kB] Get:91 http://ftpmaster.internal/ubuntu impish/main amd64 libpython3.9-minimal amd64 3.9.7-2build1 [784 kB] Get:92 http://ftpmaster.internal/ubuntu impish/main amd64 libexpat1 amd64 2.4.1-2 [90.1 kB] Get:93 http://ftpmaster.internal/ubuntu impish/main amd64 python3.9-minimal amd64 3.9.7-2build1 [2081 kB] Get:94 http://ftpmaster.internal/ubuntu impish/main amd64 python3-minimal amd64 3.9.4-1 [23.7 kB] Get:95 http://ftpmaster.internal/ubuntu impish/main amd64 media-types all 4.0.0 [22.2 kB] Get:96 http://ftpmaster.internal/ubuntu impish/main amd64 libmpdec3 amd64 2.5.1-2 [79.8 kB] Get:97 http://ftpmaster.internal/ubuntu impish/main amd64 readline-common all 8.1-2 [54.1 kB] Get:98 http://ftpmaster.internal/ubuntu impish/main amd64 libreadline8 amd64 8.1-2 [138 kB] Get:99 http://ftpmaster.internal/ubuntu impish/main amd64 libsqlite3-0 amd64 3.35.5-1 [601 kB] Get:100 http://ftpmaster.internal/ubuntu impish/main amd64 libpython3.9-stdlib amd64 3.9.7-2build1 [1807 kB] Get:101 http://ftpmaster.internal/ubuntu impish/main amd64 python3.9 amd64 3.9.7-2build1 [433 kB] Get:102 http://ftpmaster.internal/ubuntu impish/main amd64 libpython3-stdlib amd64 3.9.4-1 [6984 B] Get:103 http://ftpmaster.internal/ubuntu impish/main amd64 python3 amd64 3.9.4-1 [22.2 kB] Get:104 http://ftpmaster.internal/ubuntu impish/main amd64 libpam-runtime all 1.3.1-5ubuntu11 [38.7 kB] Get:105 http://ftpmaster.internal/ubuntu impish/main amd64 libpcre2-8-0 amd64 10.37-0ubuntu2 [219 kB] Get:106 http://ftpmaster.internal/ubuntu impish/main amd64 libsmartcols1 amd64 2.36.1-8ubuntu1 [49.7 kB] Get:107 http://ftpmaster.internal/ubuntu impish/main amd64 passwd amd64 1:4.8.1-1ubuntu9 [813 kB] Get:108 http://ftpmaster.internal/ubuntu impish/main amd64 libprocps8 amd64 2:3.3.17-5ubuntu3 [35.9 kB] Get:109 http://ftpmaster.internal/ubuntu impish/main amd64 libss2 amd64 1.46.3-1ubuntu3 [12.3 kB] Get:110 http://ftpmaster.internal/ubuntu impish/main amd64 procps amd64 2:3.3.17-5ubuntu3 [378 kB] Get:111 http://ftpmaster.internal/ubuntu impish/main amd64 usrmerge all 25ubuntu1 [53.5 kB] Get:112 http://ftpmaster.internal/ubuntu impish/main amd64 openssl amd64 1.1.1l-1ubuntu1 [651 kB] Get:113 http://ftpmaster.internal/ubuntu impish/main amd64 xz-utils amd64 5.2.5-2 [82.0 kB] Get:114 http://ftpmaster.internal/ubuntu impish/main amd64 advancecomp amd64 2.1-2.1ubuntu1 [170 kB] Get:115 http://ftpmaster.internal/ubuntu impish/main amd64 libctf0 amd64 2.37-7ubuntu1 [103 kB] Get:116 http://ftpmaster.internal/ubuntu impish/main amd64 libctf-nobfd0 amd64 2.37-7ubuntu1 [106 kB] Get:117 http://ftpmaster.internal/ubuntu impish/main amd64 binutils-x86-64-linux-gnu amd64 2.37-7ubuntu1 [2315 kB] Get:118 http://ftpmaster.internal/ubuntu impish/main amd64 binutils amd64 2.37-7ubuntu1 [3190 B] Get:119 http://ftpmaster.internal/ubuntu impish/main amd64 libbinutils amd64 2.37-7ubuntu1 [654 kB] Get:120 http://ftpmaster.internal/ubuntu impish/main amd64 binutils-common amd64 2.37-7ubuntu1 [212 kB] Get:121 http://ftpmaster.internal/ubuntu impish/main amd64 libisl23 amd64 0.24-1 [668 kB] Get:122 http://ftpmaster.internal/ubuntu impish/main amd64 cpp-11 amd64 11.2.0-7ubuntu2 [50.6 MB] Get:123 http://ftpmaster.internal/ubuntu impish/main amd64 libgcc-11-dev amd64 11.2.0-7ubuntu2 [2526 kB] Get:124 http://ftpmaster.internal/ubuntu impish/main amd64 gcc-11 amd64 11.2.0-7ubuntu2 [59.3 MB] Get:125 http://ftpmaster.internal/ubuntu impish/main amd64 libstdc++-11-dev amd64 11.2.0-7ubuntu2 [2073 kB] Get:126 http://ftpmaster.internal/ubuntu impish/main amd64 g++-11 amd64 11.2.0-7ubuntu2 [55.2 MB] Get:127 http://ftpmaster.internal/ubuntu impish/main amd64 lto-disabled-list all 16 [12.5 kB] Get:128 http://ftpmaster.internal/ubuntu impish/main amd64 python3-psutil amd64 5.8.0-1 [153 kB] Get:129 http://ftpmaster.internal/ubuntu impish/main amd64 build-essential amd64 12.9ubuntu1 [4740 B] Get:130 http://ftpmaster.internal/ubuntu impish/universe amd64 g++-10 amd64 10.3.0-11ubuntu1 [10.6 MB] Get:131 http://ftpmaster.internal/ubuntu impish/universe amd64 gcc-10 amd64 10.3.0-11ubuntu1 [19.0 MB] Get:132 http://ftpmaster.internal/ubuntu impish/main amd64 libstdc++-10-dev amd64 10.3.0-11ubuntu1 [1863 kB] Get:133 http://ftpmaster.internal/ubuntu impish/main amd64 libgcc-10-dev amd64 10.3.0-11ubuntu1 [2490 kB] Get:134 http://ftpmaster.internal/ubuntu impish/universe amd64 cpp-10 amd64 10.3.0-11ubuntu1 [9343 kB] Get:135 http://ftpmaster.internal/ubuntu impish/main amd64 gcc-10-base amd64 10.3.0-11ubuntu1 [20.7 kB] Get:136 http://ftpmaster.internal/ubuntu impish/main amd64 libassuan0 amd64 2.5.5-1 [38.4 kB] Get:137 http://ftpmaster.internal/ubuntu impish/main amd64 pinentry-curses amd64 1.1.1-1 [32.0 kB] Get:138 http://ftpmaster.internal/ubuntu impish/main amd64 gpg amd64 2.2.20-1ubuntu4 [479 kB] Get:139 http://ftpmaster.internal/ubuntu impish/main amd64 gpgconf amd64 2.2.20-1ubuntu4 [91.1 kB] Get:140 http://ftpmaster.internal/ubuntu impish/main amd64 gpg-agent amd64 2.2.20-1ubuntu4 [191 kB] Get:141 http://ftpmaster.internal/ubuntu impish/main amd64 pkgbinarymangler all 148 [32.3 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 272 MB in 20s (13.4 MB/s) (Reading database ... 13130 files and directories currently installed.) Preparing to unpack .../libcrypt-dev_1%3a4.4.18-4ubuntu1_amd64.deb ... Unpacking libcrypt-dev:amd64 (1:4.4.18-4ubuntu1) over (1:4.4.17-1ubuntu3) ... Preparing to unpack .../libnsl-dev_1.3.0-2_amd64.deb ... Unpacking libnsl-dev:amd64 (1.3.0-2) over (1.3.0-0ubuntu3) ... Preparing to unpack .../libc6-dev_2.34-0ubuntu2_amd64.deb ... Unpacking libc6-dev:amd64 (2.34-0ubuntu2) over (2.33-0ubuntu5) ... Preparing to unpack .../libc-dev-bin_2.34-0ubuntu2_amd64.deb ... Unpacking libc-dev-bin (2.34-0ubuntu2) over (2.33-0ubuntu5) ... Preparing to unpack .../libcrypt1_1%3a4.4.18-4ubuntu1_amd64.deb ... Unpacking libcrypt1:amd64 (1:4.4.18-4ubuntu1) over (1:4.4.17-1ubuntu3) ... Setting up libcrypt1:amd64 (1:4.4.18-4ubuntu1) ... (Reading database ... 13138 files and directories currently installed.) Preparing to unpack .../libtirpc-common_1.3.2-2_all.deb ... Unpacking libtirpc-common (1.3.2-2) over (1.3.1-1build1) ... Setting up libtirpc-common (1.3.2-2) ... (Reading database ... 13139 files and directories currently installed.) Preparing to unpack .../libtirpc-dev_1.3.2-2_amd64.deb ... Unpacking libtirpc-dev:amd64 (1.3.2-2) over (1.3.1-1build1) ... Preparing to unpack .../libk5crypto3_1.18.3-6_amd64.deb ... Unpacking libk5crypto3:amd64 (1.18.3-6) over (1.18.3-4) ... Setting up libk5crypto3:amd64 (1.18.3-6) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libkrb5support0_1.18.3-6_amd64.deb ... Unpacking libkrb5support0:amd64 (1.18.3-6) over (1.18.3-4) ... Setting up libkrb5support0:amd64 (1.18.3-6) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libkrb5-3_1.18.3-6_amd64.deb ... Unpacking libkrb5-3:amd64 (1.18.3-6) over (1.18.3-4) ... Setting up libkrb5-3:amd64 (1.18.3-6) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libgssapi-krb5-2_1.18.3-6_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.18.3-6) over (1.18.3-4) ... Setting up libgssapi-krb5-2:amd64 (1.18.3-6) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libcom-err2_1.46.3-1ubuntu3_amd64.deb ... Unpacking libcom-err2:amd64 (1.46.3-1ubuntu3) over (1.45.7-1ubuntu2) ... Setting up libcom-err2:amd64 (1.46.3-1ubuntu3) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libperl5.32_5.32.1-3ubuntu3_amd64.deb ... Unpacking libperl5.32:amd64 (5.32.1-3ubuntu3) over (5.32.1-3ubuntu2) ... Preparing to unpack .../perl_5.32.1-3ubuntu3_amd64.deb ... Unpacking perl (5.32.1-3ubuntu3) over (5.32.1-3ubuntu2) ... Preparing to unpack .../perl-base_5.32.1-3ubuntu3_amd64.deb ... Unpacking perl-base (5.32.1-3ubuntu3) over (5.32.1-3ubuntu2) ... Setting up perl-base (5.32.1-3ubuntu3) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../perl-modules-5.32_5.32.1-3ubuntu3_all.deb ... Unpacking perl-modules-5.32 (5.32.1-3ubuntu3) over (5.32.1-3ubuntu2) ... Preparing to unpack .../libdb5.3_5.3.28+dfsg1-0.8ubuntu1_amd64.deb ... Unpacking libdb5.3:amd64 (5.3.28+dfsg1-0.8ubuntu1) over (5.3.28+dfsg1-0.6ubuntu4) ... Setting up libdb5.3:amd64 (5.3.28+dfsg1-0.8ubuntu1) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../zlib1g_1%3a1.2.11.dfsg-2ubuntu7_amd64.deb ... Unpacking zlib1g:amd64 (1:1.2.11.dfsg-2ubuntu7) over (1:1.2.11.dfsg-2ubuntu6) ... Setting up zlib1g:amd64 (1:1.2.11.dfsg-2ubuntu7) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../debconf_1.5.77_all.deb ... Unpacking debconf (1.5.77) over (1.5.74) ... Setting up debconf (1.5.77) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libc6_2.34-0ubuntu2_amd64.deb ... Unpacking libc6:amd64 (2.34-0ubuntu2) over (2.33-0ubuntu5) ... Setting up libc6:amd64 (2.34-0ubuntu2) ... (Reading database ... 13126 files and directories currently installed.) Preparing to unpack .../libc-bin_2.34-0ubuntu2_amd64.deb ... Unpacking libc-bin (2.34-0ubuntu2) over (2.33-0ubuntu5) ... Setting up libc-bin (2.34-0ubuntu2) ... (Reading database ... 13126 files and directories currently installed.) Preparing to unpack .../libssl1.1_1.1.1l-1ubuntu1_amd64.deb ... Unpacking libssl1.1:amd64 (1.1.1l-1ubuntu1) over (1.1.1j-1ubuntu3) ... Setting up libssl1.1:amd64 (1.1.1l-1ubuntu1) ... (Reading database ... 13126 files and directories currently installed.) Preparing to unpack .../libtirpc3_1.3.2-2_amd64.deb ... Unpacking libtirpc3:amd64 (1.3.2-2) over (1.3.1-1build1) ... Setting up libtirpc3:amd64 (1.3.2-2) ... (Reading database ... 13127 files and directories currently installed.) Preparing to unpack .../libnsl2_1.3.0-2_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-2) over (1.3.0-0ubuntu3) ... Setting up libnsl2:amd64 (1.3.0-2) ... (Reading database ... 13127 files and directories currently installed.) Preparing to unpack .../0-linux-libc-dev_5.13.0-16.16_amd64.deb ... Unpacking linux-libc-dev:amd64 (5.13.0-16.16) over (5.11.0-14.15) ... Preparing to unpack .../1-libasan6_11.2.0-7ubuntu2_amd64.deb ... Unpacking libasan6:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../2-libubsan1_11.2.0-7ubuntu2_amd64.deb ... Unpacking libubsan1:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../3-libtsan0_11.2.0-7ubuntu2_amd64.deb ... Unpacking libtsan0:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../4-libquadmath0_11.2.0-7ubuntu2_amd64.deb ... Unpacking libquadmath0:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../5-liblsan0_11.2.0-7ubuntu2_amd64.deb ... Unpacking liblsan0:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../6-libitm1_11.2.0-7ubuntu2_amd64.deb ... Unpacking libitm1:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../7-libgomp1_11.2.0-7ubuntu2_amd64.deb ... Unpacking libgomp1:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../8-gcc-11-base_11.2.0-7ubuntu2_amd64.deb ... Unpacking gcc-11-base:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Setting up gcc-11-base:amd64 (11.2.0-7ubuntu2) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libgcc-s1_11.2.0-7ubuntu2_amd64.deb ... Unpacking libgcc-s1:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Setting up libgcc-s1:amd64 (11.2.0-7ubuntu2) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libcc1-0_11.2.0-7ubuntu2_amd64.deb ... Unpacking libcc1-0:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libatomic1_11.2.0-7ubuntu2_amd64.deb ... Unpacking libatomic1:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Preparing to unpack .../libstdc++6_11.2.0-7ubuntu2_amd64.deb ... Unpacking libstdc++6:amd64 (11.2.0-7ubuntu2) over (11-20210417-1ubuntu1) ... Setting up libstdc++6:amd64 (11.2.0-7ubuntu2) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../base-files_11.1ubuntu3_amd64.deb ... Unpacking base-files (11.1ubuntu3) over (11ubuntu18) ... Setting up base-files (11.1ubuntu3) ... Installing new version of config file /etc/debian_version ... Installing new version of config file /etc/dpkg/origins/debian ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... Updating /etc/profile to current default. (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../bash_5.1-3ubuntu1_amd64.deb ... Unpacking bash (5.1-3ubuntu1) over (5.1-2ubuntu1) ... Setting up bash (5.1-3ubuntu1) ... update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../bsdutils_1%3a2.36.1-8ubuntu1_amd64.deb ... Unpacking bsdutils (1:2.36.1-8ubuntu1) over (1:2.36.1-7ubuntu2) ... Setting up bsdutils (1:2.36.1-8ubuntu1) ... (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../dpkg_1.20.9ubuntu13_amd64.deb ... Unpacking dpkg (1.20.9ubuntu13) over (1.20.7.1ubuntu4) ... Setting up dpkg (1.20.9ubuntu13) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../dash_0.5.11+git20210120+802ebd4-1_amd64.deb ... Unpacking dash (0.5.11+git20210120+802ebd4-1) over (0.5.11+git20200708+dd9ef66+really0.5.11+git20200708+dd9ef66-5ubuntu1) ... Setting up dash (0.5.11+git20210120+802ebd4-1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../diffutils_1%3a3.8-0ubuntu1_amd64.deb ... Unpacking diffutils (1:3.8-0ubuntu1) over (1:3.7-3ubuntu1) ... Setting up diffutils (1:3.8-0ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../findutils_4.8.0-1ubuntu2_amd64.deb ... Unpacking findutils (4.8.0-1ubuntu2) over (4.8.0-1ubuntu1) ... Setting up findutils (4.8.0-1ubuntu2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../grep_3.7-0ubuntu1_amd64.deb ... Unpacking grep (3.7-0ubuntu1) over (3.6-1) ... Setting up grep (3.7-0ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../gzip_1.10-4ubuntu1_amd64.deb ... Unpacking gzip (1.10-4ubuntu1) over (1.10-2ubuntu3) ... Setting up gzip (1.10-4ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../login_1%3a4.8.1-1ubuntu9_amd64.deb ... Unpacking login (1:4.8.1-1ubuntu9) over (1:4.8.1-1ubuntu8) ... Setting up login (1:4.8.1-1ubuntu9) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../util-linux_2.36.1-8ubuntu1_amd64.deb ... Unpacking util-linux (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Setting up util-linux (2.36.1-8ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../base-passwd_3.5.51_amd64.deb ... Unpacking base-passwd (3.5.51) over (3.5.49) ... Setting up base-passwd (3.5.51) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../sysvinit-utils_2.96-7ubuntu1_amd64.deb ... Unpacking sysvinit-utils (2.96-7ubuntu1) over (2.96-6ubuntu1) ... Setting up sysvinit-utils (2.96-7ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libgcrypt20_1.8.7-5ubuntu2_amd64.deb ... Unpacking libgcrypt20:amd64 (1.8.7-5ubuntu2) over (1.8.7-2ubuntu2) ... Setting up libgcrypt20:amd64 (1.8.7-5ubuntu2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../liblz4-1_1.9.3-2_amd64.deb ... Unpacking liblz4-1:amd64 (1.9.3-2) over (1.9.3-1build1) ... Setting up liblz4-1:amd64 (1.9.3-2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../liblzma5_5.2.5-2_amd64.deb ... Unpacking liblzma5:amd64 (5.2.5-2) over (5.2.5-1.0build2) ... Setting up liblzma5:amd64 (5.2.5-2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../systemd-sysv_248.3-1ubuntu7_amd64.deb ... Unpacking systemd-sysv (248.3-1ubuntu7) over (247.3-3ubuntu3) ... Preparing to unpack .../systemd-timesyncd_248.3-1ubuntu7_amd64.deb ... Unpacking systemd-timesyncd (248.3-1ubuntu7) over (247.3-3ubuntu3) ... Preparing to unpack .../libapparmor1_3.0.3-0ubuntu1_amd64.deb ... Unpacking libapparmor1:amd64 (3.0.3-0ubuntu1) over (3.0.0-0ubuntu7) ... Preparing to unpack .../libaudit-common_1%3a3.0-2ubuntu2_all.deb ... Unpacking libaudit-common (1:3.0-2ubuntu2) over (1:3.0-2ubuntu1) ... Setting up libaudit-common (1:3.0-2ubuntu2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a3.0-2ubuntu2_amd64.deb ... Unpacking libaudit1:amd64 (1:3.0-2ubuntu2) over (1:3.0-2ubuntu1) ... Setting up libaudit1:amd64 (1:3.0-2ubuntu2) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libblkid1_2.36.1-8ubuntu1_amd64.deb ... Unpacking libblkid1:amd64 (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Setting up libblkid1:amd64 (2.36.1-8ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libudev1_248.3-1ubuntu7_amd64.deb ... Unpacking libudev1:amd64 (248.3-1ubuntu7) over (247.3-3ubuntu3) ... Setting up libudev1:amd64 (248.3-1ubuntu7) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.175-2.1ubuntu1_amd64.deb ... Unpacking libdevmapper1.02.1:amd64 (2:1.02.175-2.1ubuntu1) over (2:1.02.175-2ubuntu4) ... Preparing to unpack .../libuuid1_2.36.1-8ubuntu1_amd64.deb ... Unpacking libuuid1:amd64 (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Setting up libuuid1:amd64 (2.36.1-8ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libcryptsetup12_2%3a2.3.6-0ubuntu1_amd64.deb ... Unpacking libcryptsetup12:amd64 (2:2.3.6-0ubuntu1) over (2:2.3.4-1ubuntu3) ... Preparing to unpack .../libnettle8_3.7.3-1_amd64.deb ... Unpacking libnettle8:amd64 (3.7.3-1) over (3.7-2.1ubuntu1) ... Setting up libnettle8:amd64 (3.7.3-1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libhogweed6_3.7.3-1_amd64.deb ... Unpacking libhogweed6:amd64 (3.7.3-1) over (3.7-2.1ubuntu1) ... Setting up libhogweed6:amd64 (3.7.3-1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libunistring2_0.9.10-6_amd64.deb ... Unpacking libunistring2:amd64 (0.9.10-6) over (0.9.10-4) ... Setting up libunistring2:amd64 (0.9.10-6) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libidn2-0_2.3.1-1_amd64.deb ... Unpacking libidn2-0:amd64 (2.3.1-1) over (2.3.0-5) ... Setting up libidn2-0:amd64 (2.3.1-1) ... dpkg: libffi8ubuntu1:amd64: dependency problems, but removing anyway as you requested: libp11-kit0:amd64 depends on libffi8ubuntu1 (>= 3.4~20200819). (Reading database ... 13145 files and directories currently installed.) Removing libffi8ubuntu1:amd64 (3.4~20200819gead65ca871-0ubuntu5) ... Selecting previously unselected package libffi8:amd64. (Reading database ... 13140 files and directories currently installed.) Preparing to unpack .../libffi8_3.4.2-1ubuntu5_amd64.deb ... Unpacking libffi8:amd64 (3.4.2-1ubuntu5) ... Setting up libffi8:amd64 (3.4.2-1ubuntu5) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libp11-kit0_0.23.22-1build1_amd64.deb ... Unpacking libp11-kit0:amd64 (0.23.22-1build1) over (0.23.22-1) ... Setting up libp11-kit0:amd64 (0.23.22-1build1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libgnutls30_3.7.1-5ubuntu1_amd64.deb ... Unpacking libgnutls30:amd64 (3.7.1-5ubuntu1) over (3.7.1-3ubuntu1) ... Setting up libgnutls30:amd64 (3.7.1-5ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libzstd1_1.4.8+dfsg-2.1_amd64.deb ... Unpacking libzstd1:amd64 (1.4.8+dfsg-2.1) over (1.4.8+dfsg-2build2) ... Setting up libzstd1:amd64 (1.4.8+dfsg-2.1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libkmod2_28-1ubuntu4_amd64.deb ... Unpacking libkmod2:amd64 (28-1ubuntu4) over (28-1ubuntu2) ... Preparing to unpack .../libmount1_2.36.1-8ubuntu1_amd64.deb ... Unpacking libmount1:amd64 (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Setting up libmount1:amd64 (2.36.1-8ubuntu1) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../libpam0g_1.3.1-5ubuntu11_amd64.deb ... Unpacking libpam0g:amd64 (1.3.1-5ubuntu11) over (1.3.1-5ubuntu6) ... Setting up libpam0g:amd64 (1.3.1-5ubuntu11) ... (Reading database ... 13145 files and directories currently installed.) Preparing to unpack .../mount_2.36.1-8ubuntu1_amd64.deb ... Unpacking mount (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Preparing to unpack .../systemd_248.3-1ubuntu7_amd64.deb ... Unpacking systemd (248.3-1ubuntu7) over (247.3-3ubuntu3) ... Preparing to unpack .../libsystemd0_248.3-1ubuntu7_amd64.deb ... Unpacking libsystemd0:amd64 (248.3-1ubuntu7) over (247.3-3ubuntu3) ... Setting up libsystemd0:amd64 (248.3-1ubuntu7) ... (Reading database ... 13160 files and directories currently installed.) Preparing to unpack .../libapt-pkg6.0_2.3.9_amd64.deb ... Unpacking libapt-pkg6.0:amd64 (2.3.9) over (2.2.3) ... Setting up libapt-pkg6.0:amd64 (2.3.9) ... (Reading database ... 13160 files and directories currently installed.) Preparing to unpack .../gpgv_2.2.20-1ubuntu4_amd64.deb ... Unpacking gpgv (2.2.20-1ubuntu4) over (2.2.20-1ubuntu3) ... Setting up gpgv (2.2.20-1ubuntu4) ... (Reading database ... 13160 files and directories currently installed.) Preparing to unpack .../archives/apt_2.3.9_amd64.deb ... Unpacking apt (2.3.9) over (2.2.3) ... Setting up apt (2.3.9) ... (Reading database ... 13160 files and directories currently installed.) Preparing to unpack .../libpam-modules-bin_1.3.1-5ubuntu11_amd64.deb ... Unpacking libpam-modules-bin (1.3.1-5ubuntu11) over (1.3.1-5ubuntu6) ... Setting up libpam-modules-bin (1.3.1-5ubuntu11) ... (Reading database ... 13162 files and directories currently installed.) Preparing to unpack .../libpam-modules_1.3.1-5ubuntu11_amd64.deb ... Unpacking libpam-modules:amd64 (1.3.1-5ubuntu11) over (1.3.1-5ubuntu6) ... Setting up libpam-modules:amd64 (1.3.1-5ubuntu11) ... (Reading database ... 13166 files and directories currently installed.) Preparing to unpack .../logsave_1.46.3-1ubuntu3_amd64.deb ... Unpacking logsave (1.46.3-1ubuntu3) over (1.45.7-1ubuntu2) ... Preparing to unpack .../libext2fs2_1.46.3-1ubuntu3_amd64.deb ... Unpacking libext2fs2:amd64 (1.46.3-1ubuntu3) over (1.45.7-1ubuntu2) ... Setting up libext2fs2:amd64 (1.46.3-1ubuntu3) ... (Reading database ... 13166 files and directories currently installed.) Preparing to unpack .../e2fsprogs_1.46.3-1ubuntu3_amd64.deb ... Unpacking e2fsprogs (1.46.3-1ubuntu3) over (1.45.7-1ubuntu2) ... Selecting previously unselected package libpython3.9-minimal:amd64. Preparing to unpack .../libpython3.9-minimal_3.9.7-2build1_amd64.deb ... Unpacking libpython3.9-minimal:amd64 (3.9.7-2build1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.4.1-2_amd64.deb ... Unpacking libexpat1:amd64 (2.4.1-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../python3.9-minimal_3.9.7-2build1_amd64.deb ... Unpacking python3.9-minimal (3.9.7-2build1) ... Setting up libpython3.9-minimal:amd64 (3.9.7-2build1) ... Setting up libexpat1:amd64 (2.4.1-2) ... Setting up python3.9-minimal (3.9.7-2build1) ... Selecting previously unselected package python3-minimal. (Reading database ... 13459 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.4-1_amd64.deb ... Unpacking python3-minimal (3.9.4-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:amd64. Preparing to unpack .../2-libmpdec3_2.5.1-2_amd64.deb ... Unpacking libmpdec3:amd64 (2.5.1-2) ... Preparing to unpack .../3-readline-common_8.1-2_all.deb ... Unpacking readline-common (8.1-2) over (8.1-1) ... Preparing to unpack .../4-libreadline8_8.1-2_amd64.deb ... Unpacking libreadline8:amd64 (8.1-2) over (8.1-1) ... Preparing to unpack .../5-libsqlite3-0_3.35.5-1_amd64.deb ... Unpacking libsqlite3-0:amd64 (3.35.5-1) over (3.34.1-3) ... Selecting previously unselected package libpython3.9-stdlib:amd64. Preparing to unpack .../6-libpython3.9-stdlib_3.9.7-2build1_amd64.deb ... Unpacking libpython3.9-stdlib:amd64 (3.9.7-2build1) ... Selecting previously unselected package python3.9. Preparing to unpack .../7-python3.9_3.9.7-2build1_amd64.deb ... Unpacking python3.9 (3.9.7-2build1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../8-libpython3-stdlib_3.9.4-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.9.4-1) ... Setting up python3-minimal (3.9.4-1) ... Selecting previously unselected package python3. (Reading database ... 13856 files and directories currently installed.) Preparing to unpack .../python3_3.9.4-1_amd64.deb ... Unpacking python3 (3.9.4-1) ... Preparing to unpack .../libpam-runtime_1.3.1-5ubuntu11_all.deb ... Unpacking libpam-runtime (1.3.1-5ubuntu11) over (1.3.1-5ubuntu6) ... Setting up libpam-runtime (1.3.1-5ubuntu11) ... (Reading database ... 13876 files and directories currently installed.) Preparing to unpack .../libpcre2-8-0_10.37-0ubuntu2_amd64.deb ... Unpacking libpcre2-8-0:amd64 (10.37-0ubuntu2) over (10.36-2ubuntu5) ... Setting up libpcre2-8-0:amd64 (10.37-0ubuntu2) ... (Reading database ... 13876 files and directories currently installed.) Preparing to unpack .../libsmartcols1_2.36.1-8ubuntu1_amd64.deb ... Unpacking libsmartcols1:amd64 (2.36.1-8ubuntu1) over (2.36.1-7ubuntu2) ... Setting up libsmartcols1:amd64 (2.36.1-8ubuntu1) ... (Reading database ... 13876 files and directories currently installed.) Preparing to unpack .../passwd_1%3a4.8.1-1ubuntu9_amd64.deb ... Unpacking passwd (1:4.8.1-1ubuntu9) over (1:4.8.1-1ubuntu8) ... Setting up passwd (1:4.8.1-1ubuntu9) ... (Reading database ... 13876 files and directories currently installed.) Preparing to unpack .../00-libprocps8_2%3a3.3.17-5ubuntu3_amd64.deb ... Unpacking libprocps8:amd64 (2:3.3.17-5ubuntu3) over (2:3.3.16-5ubuntu3) ... Preparing to unpack .../01-libss2_1.46.3-1ubuntu3_amd64.deb ... Unpacking libss2:amd64 (1.46.3-1ubuntu3) over (1.45.7-1ubuntu2) ... Preparing to unpack .../02-procps_2%3a3.3.17-5ubuntu3_amd64.deb ... Unpacking procps (2:3.3.17-5ubuntu3) over (2:3.3.16-5ubuntu3) ... Preparing to unpack .../03-usrmerge_25ubuntu1_all.deb ... Unpacking usrmerge (25ubuntu1) over (24ubuntu3) ... Preparing to unpack .../04-openssl_1.1.1l-1ubuntu1_amd64.deb ... Unpacking openssl (1.1.1l-1ubuntu1) over (1.1.1j-1ubuntu3) ... Preparing to unpack .../05-xz-utils_5.2.5-2_amd64.deb ... Unpacking xz-utils (5.2.5-2) over (5.2.5-1.0build2) ... Preparing to unpack .../06-advancecomp_2.1-2.1ubuntu1_amd64.deb ... Unpacking advancecomp (2.1-2.1ubuntu1) over (2.1-2.1build1) ... Preparing to unpack .../07-libctf0_2.37-7ubuntu1_amd64.deb ... Unpacking libctf0:amd64 (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../08-libctf-nobfd0_2.37-7ubuntu1_amd64.deb ... Unpacking libctf-nobfd0:amd64 (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../09-binutils-x86-64-linux-gnu_2.37-7ubuntu1_amd64.deb ... Unpacking binutils-x86-64-linux-gnu (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../10-binutils_2.37-7ubuntu1_amd64.deb ... Unpacking binutils (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../11-libbinutils_2.37-7ubuntu1_amd64.deb ... Unpacking libbinutils:amd64 (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../12-binutils-common_2.37-7ubuntu1_amd64.deb ... Unpacking binutils-common:amd64 (2.37-7ubuntu1) over (2.36.1-6ubuntu1) ... Preparing to unpack .../13-libisl23_0.24-1_amd64.deb ... Unpacking libisl23:amd64 (0.24-1) over (0.23-1build1) ... Selecting previously unselected package cpp-11. Preparing to unpack .../14-cpp-11_11.2.0-7ubuntu2_amd64.deb ... Unpacking cpp-11 (11.2.0-7ubuntu2) ... Preparing to unpack .../15-g++_4%3a11.2.0-1ubuntu1_amd64.deb ... Unpacking g++ (4:11.2.0-1ubuntu1) over (4:10.3.0-1ubuntu1) ... Preparing to unpack .../16-gcc_4%3a11.2.0-1ubuntu1_amd64.deb ... Unpacking gcc (4:11.2.0-1ubuntu1) over (4:10.3.0-1ubuntu1) ... Preparing to unpack .../17-cpp_4%3a11.2.0-1ubuntu1_amd64.deb ... Unpacking cpp (4:11.2.0-1ubuntu1) over (4:10.3.0-1ubuntu1) ... Selecting previously unselected package libgcc-11-dev:amd64. Preparing to unpack .../18-libgcc-11-dev_11.2.0-7ubuntu2_amd64.deb ... Unpacking libgcc-11-dev:amd64 (11.2.0-7ubuntu2) ... Selecting previously unselected package gcc-11. Preparing to unpack .../19-gcc-11_11.2.0-7ubuntu2_amd64.deb ... Unpacking gcc-11 (11.2.0-7ubuntu2) ... Selecting previously unselected package libstdc++-11-dev:amd64. Preparing to unpack .../20-libstdc++-11-dev_11.2.0-7ubuntu2_amd64.deb ... Unpacking libstdc++-11-dev:amd64 (11.2.0-7ubuntu2) ... Selecting previously unselected package g++-11. Preparing to unpack .../21-g++-11_11.2.0-7ubuntu2_amd64.deb ... Unpacking g++-11 (11.2.0-7ubuntu2) ... Preparing to unpack .../22-dpkg-dev_1.20.9ubuntu13_all.deb ... Unpacking dpkg-dev (1.20.9ubuntu13) over (1.20.7.1ubuntu4) ... Preparing to unpack .../23-libdpkg-perl_1.20.9ubuntu13_all.deb ... Unpacking libdpkg-perl (1.20.9ubuntu13) over (1.20.7.1ubuntu4) ... Preparing to unpack .../24-lto-disabled-list_16_all.deb ... Unpacking lto-disabled-list (16) over (7) ... Selecting previously unselected package python3-psutil. Preparing to unpack .../25-python3-psutil_5.8.0-1_amd64.deb ... Unpacking python3-psutil (5.8.0-1) ... Preparing to unpack .../26-build-essential_12.9ubuntu1_amd64.deb ... Unpacking build-essential (12.9ubuntu1) over (12.8ubuntu3) ... Preparing to unpack .../27-g++-10_10.3.0-11ubuntu1_amd64.deb ... Unpacking g++-10 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../28-gcc-10_10.3.0-11ubuntu1_amd64.deb ... Unpacking gcc-10 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../29-libstdc++-10-dev_10.3.0-11ubuntu1_amd64.deb ... Unpacking libstdc++-10-dev:amd64 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../30-libgcc-10-dev_10.3.0-11ubuntu1_amd64.deb ... Unpacking libgcc-10-dev:amd64 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../31-cpp-10_10.3.0-11ubuntu1_amd64.deb ... Unpacking cpp-10 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../32-gcc-10-base_10.3.0-11ubuntu1_amd64.deb ... Unpacking gcc-10-base:amd64 (10.3.0-11ubuntu1) over (10.3.0-1ubuntu1) ... Preparing to unpack .../33-libassuan0_2.5.5-1_amd64.deb ... Unpacking libassuan0:amd64 (2.5.5-1) over (2.5.4-1ubuntu1) ... Preparing to unpack .../34-pinentry-curses_1.1.1-1_amd64.deb ... Unpacking pinentry-curses (1.1.1-1) over (1.1.0-4build1) ... Preparing to unpack .../35-gpg_2.2.20-1ubuntu4_amd64.deb ... Unpacking gpg (2.2.20-1ubuntu4) over (2.2.20-1ubuntu3) ... Preparing to unpack .../36-gpgconf_2.2.20-1ubuntu4_amd64.deb ... Unpacking gpgconf (2.2.20-1ubuntu4) over (2.2.20-1ubuntu3) ... Preparing to unpack .../37-gpg-agent_2.2.20-1ubuntu4_amd64.deb ... Unpacking gpg-agent (2.2.20-1ubuntu4) over (2.2.20-1ubuntu3) ... Preparing to unpack .../38-pkgbinarymangler_148_all.deb ... Unpacking pkgbinarymangler (148) over (147) ... Setting up media-types (4.0.0) ... Setting up lto-disabled-list (16) ... Setting up libapparmor1:amd64 (3.0.3-0ubuntu1) ... Setting up perl-modules-5.32 (5.32.1-3ubuntu3) ... Setting up libsqlite3-0:amd64 (3.35.5-1) ... Setting up binutils-common:amd64 (2.37-7ubuntu1) ... Setting up linux-libc-dev:amd64 (5.13.0-16.16) ... Setting up libctf-nobfd0:amd64 (2.37-7ubuntu1) ... Setting up libassuan0:amd64 (2.5.5-1) ... Setting up libgomp1:amd64 (11.2.0-7ubuntu2) ... Setting up libasan6:amd64 (11.2.0-7ubuntu2) ... Setting up gcc-10-base:amd64 (10.3.0-11ubuntu1) ... Setting up libtirpc-dev:amd64 (1.3.2-2) ... Setting up xz-utils (5.2.5-2) ... Setting up libquadmath0:amd64 (11.2.0-7ubuntu2) ... Setting up libatomic1:amd64 (11.2.0-7ubuntu2) ... Setting up usrmerge (25ubuntu1) ... Setting up libss2:amd64 (1.46.3-1ubuntu3) ... Setting up libperl5.32:amd64 (5.32.1-3ubuntu3) ... Setting up logsave (1.46.3-1ubuntu3) ... Setting up libubsan1:amd64 (11.2.0-7ubuntu2) ... Setting up advancecomp (2.1-2.1ubuntu1) ... Setting up libdevmapper1.02.1:amd64 (2:1.02.175-2.1ubuntu1) ... Setting up mount (2.36.1-8ubuntu1) ... Setting up libnsl-dev:amd64 (1.3.0-2) ... Setting up libcrypt-dev:amd64 (1:4.4.18-4ubuntu1) ... Setting up libmpdec3:amd64 (2.5.1-2) ... Setting up libcryptsetup12:amd64 (2:2.3.6-0ubuntu1) ... Setting up libbinutils:amd64 (2.37-7ubuntu1) ... Setting up libisl23:amd64 (0.24-1) ... Setting up libc-dev-bin (2.34-0ubuntu2) ... Setting up openssl (1.1.1l-1ubuntu1) ... Setting up readline-common (8.1-2) ... Setting up libcc1-0:amd64 (11.2.0-7ubuntu2) ... Setting up liblsan0:amd64 (11.2.0-7ubuntu2) ... Setting up libprocps8:amd64 (2:3.3.17-5ubuntu3) ... Setting up cpp-10 (10.3.0-11ubuntu1) ... Setting up libitm1:amd64 (11.2.0-7ubuntu2) ... Setting up libkmod2:amd64 (28-1ubuntu4) ... Setting up libtsan0:amd64 (11.2.0-7ubuntu2) ... Setting up libctf0:amd64 (2.37-7ubuntu1) ... Setting up pinentry-curses (1.1.1-1) ... Setting up cpp-11 (11.2.0-7ubuntu2) ... Setting up pkgbinarymangler (148) ... Setting up libgcc-10-dev:amd64 (10.3.0-11ubuntu1) ... Setting up libreadline8:amd64 (8.1-2) ... Setting up e2fsprogs (1.46.3-1ubuntu3) ... Setting up perl (5.32.1-3ubuntu3) ... Setting up libdpkg-perl (1.20.9ubuntu13) ... Setting up libgcc-11-dev:amd64 (11.2.0-7ubuntu2) ... Setting up cpp (4:11.2.0-1ubuntu1) ... Setting up procps (2:3.3.17-5ubuntu3) ... update-alternatives: warning: alternative /usr/bin/w.procps (part of link group w) doesn't exist; removing from list of alternatives update-alternatives: warning: /etc/alternatives/w is dangling; it will be updated with best choice Setting up gpgconf (2.2.20-1ubuntu4) ... Setting up libc6-dev:amd64 (2.34-0ubuntu2) ... Setting up gpg (2.2.20-1ubuntu4) ... Setting up libpython3.9-stdlib:amd64 (3.9.7-2build1) ... Setting up libpython3-stdlib:amd64 (3.9.4-1) ... Setting up binutils-x86-64-linux-gnu (2.37-7ubuntu1) ... Setting up libstdc++-10-dev:amd64 (10.3.0-11ubuntu1) ... Setting up gpg-agent (2.2.20-1ubuntu4) ... Setting up binutils (2.37-7ubuntu1) ... Setting up gcc-10 (10.3.0-11ubuntu1) ... Setting up libstdc++-11-dev:amd64 (11.2.0-7ubuntu2) ... Setting up gcc-11 (11.2.0-7ubuntu2) ... Setting up python3.9 (3.9.7-2build1) ... Setting up g++-10 (10.3.0-11ubuntu1) ... Setting up g++-11 (11.2.0-7ubuntu2) ... Setting up python3 (3.9.4-1) ... Setting up python3-psutil (5.8.0-1) ... Setting up gcc (4:11.2.0-1ubuntu1) ... Setting up dpkg-dev (1.20.9ubuntu13) ... Setting up g++ (4:11.2.0-1ubuntu1) ... Setting up build-essential (12.9ubuntu1) ... Setting up systemd-timesyncd (248.3-1ubuntu7) ... Installing new version of config file /etc/systemd/timesyncd.conf ... Setting up systemd (248.3-1ubuntu7) ... Installing new version of config file /etc/systemd/journald.conf ... Installing new version of config file /etc/systemd/logind.conf ... Installing new version of config file /etc/systemd/networkd.conf ... Installing new version of config file /etc/systemd/pstore.conf ... Installing new version of config file /etc/systemd/resolved.conf ... Installing new version of config file /etc/systemd/sleep.conf ... Installing new version of config file /etc/systemd/system.conf ... Installing new version of config file /etc/systemd/user.conf ... Initializing machine ID from random generator. Setting up systemd-sysv (248.3-1ubuntu7) ... Processing triggers for libc-bin (2.34-0ubuntu2) ... RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-22120063 amd64 impish -c chroot:build-PACKAGEBUILD-22120063 --arch=amd64 --dist=impish --nolog -A ataqv_1.2.1+ds-1build1.dsc Initiating build PACKAGEBUILD-22120063 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 4.15.0-158-generic #166-Ubuntu SMP Fri Sep 17 19:37:52 UTC 2021 x86_64 sbuild (Debian sbuild) 0.75.0 (21 Mar 2018) on lgw01-amd64-046.buildd +==============================================================================+ | ataqv 1.2.1+ds-1build1 (amd64) Wed, 29 Sep 2021 04:15:27 +0000 | +==============================================================================+ Package: ataqv Version: 1.2.1+ds-1build1 Source Version: 1.2.1+ds-1build1 Distribution: impish Machine Architecture: amd64 Host Architecture: amd64 Build Architecture: amd64 Build Type: binary I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-22120063/chroot-autobuild' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- ataqv_1.2.1+ds-1build1.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/ataqv-utpSY7/ataqv-1.2.1+ds' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-utpSY7' with '<>' +------------------------------------------------------------------------------+ | Install build-essential | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<>/resolver-zeK8Mx/apt_archive/sbuild-build-depends-core-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 1 entries to output Packages file. Ign:1 copy:/<>/resolver-zeK8Mx/apt_archive ./ InRelease Get:2 copy:/<>/resolver-zeK8Mx/apt_archive ./ Release [957 B] Ign:3 copy:/<>/resolver-zeK8Mx/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-zeK8Mx/apt_archive ./ Sources [349 B] Get:5 copy:/<>/resolver-zeK8Mx/apt_archive ./ Packages [433 B] Fetched 1739 B in 0s (59.1 kB/s) Reading package lists... Reading package lists... Install core build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: cpp-10 g++-10 gcc-10 gcc-10-base libgcc-10-dev libstdc++-10-dev Use 'apt autoremove' to remove them. The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 652 B of archives. After this operation, 0 B of additional disk space will be used. Get:1 copy:/<>/resolver-zeK8Mx/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [652 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 652 B in 0s (37.8 kB/s) Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... 15067 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in any) +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3 dpkg-deb: building package 'sbuild-build-depends-ataqv-dummy' in '/<>/resolver-zeK8Mx/apt_archive/sbuild-build-depends-ataqv-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-ataqv-dummy sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 2 entries to output Packages file. Ign:1 copy:/<>/resolver-zeK8Mx/apt_archive ./ InRelease Get:2 copy:/<>/resolver-zeK8Mx/apt_archive ./ Release [963 B] Ign:3 copy:/<>/resolver-zeK8Mx/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-zeK8Mx/apt_archive ./ Sources [615 B] Get:5 copy:/<>/resolver-zeK8Mx/apt_archive ./ Packages [697 B] Fetched 2275 B in 0s (35.1 kB/s) Reading package lists... Reading package lists... Install ataqv build dependencies (apt-based resolver) ----------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following package was automatically installed and is no longer required: g++-10 Use 'apt autoremove' to remove it. The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap-2.5-0 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libuv1 libxml2 m4 man-db node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw nodejs po-debconf zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libboost1.74-doc libboost-atomic1.74-dev libboost-container1.74-dev libboost-context1.74-dev libboost-contract1.74-dev libboost-coroutine1.74-dev libboost-date-time1.74-dev libboost-exception1.74-dev libboost-fiber1.74-dev libboost-graph1.74-dev libboost-graph-parallel1.74-dev libboost-locale1.74-dev libboost-log1.74-dev libboost-math1.74-dev libboost-mpi1.74-dev libboost-mpi-python1.74-dev libboost-numpy1.74-dev libboost-program-options1.74-dev libboost-python1.74-dev libboost-random1.74-dev libboost-serialization1.74-dev libboost-stacktrace1.74-dev libboost-test1.74-dev libboost-thread1.74-dev libboost-timer1.74-dev libboost-type-erasure1.74-dev libboost-wave1.74-dev libboost1.74-tools-dev libmpfrc++-dev libntl-dev libboost-nowide1.74-dev libcurl4-doc libgnutls28-dev libidn11-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libjs-html5shiv npm libmail-box-perl Recommended packages: curl | wget | lynx libarchive-cpio-perl javascript-common libldap-common publicsuffix libsasl2-modules libltdl-dev nodejs-doc libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libc-ares2 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu67 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap-2.5-0 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libnode72 libpipeline1 libpsl5 librtmp1 libsasl2-2 libsasl2-modules-db libsigsegv2 libssh-4 libsub-override-perl libtool libuchardet0 libuv1 libxml2 m4 man-db node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw nodejs po-debconf sbuild-build-depends-ataqv-dummy zlib1g-dev 0 upgraded, 117 newly installed, 0 to remove and 0 not upgraded. Need to get 62.9 MB of archives. After this operation, 348 MB of additional disk space will be used. Get:1 copy:/<>/resolver-zeK8Mx/apt_archive ./ sbuild-build-depends-ataqv-dummy 0.invalid.0 [782 B] Get:2 http://ftpmaster.internal/ubuntu impish/main amd64 liblocale-gettext-perl amd64 1.07-4build1 [16.9 kB] Get:3 http://ftpmaster.internal/ubuntu impish/main amd64 bsdextrautils amd64 2.36.1-8ubuntu1 [75.4 kB] Get:4 http://ftpmaster.internal/ubuntu impish/main amd64 libuchardet0 amd64 0.0.7-1 [68.0 kB] Get:5 http://ftpmaster.internal/ubuntu impish/main amd64 groff-base amd64 1.22.4-7 [956 kB] Get:6 http://ftpmaster.internal/ubuntu impish/main amd64 libpipeline1 amd64 1.5.3-1 [27.8 kB] Get:7 http://ftpmaster.internal/ubuntu impish/main amd64 man-db amd64 2.9.4-2 [1154 kB] Get:8 http://ftpmaster.internal/ubuntu impish/universe amd64 node-normalize.css all 8.0.1-3 [10.3 kB] Get:9 http://ftpmaster.internal/ubuntu impish/main amd64 libelf1 amd64 0.185-1 [47.2 kB] Get:10 http://ftpmaster.internal/ubuntu impish/main amd64 libicu67 amd64 67.1-7ubuntu1 [10.1 MB] Get:11 http://ftpmaster.internal/ubuntu impish/main amd64 libxml2 amd64 2.9.12+dfsg-4 [761 kB] Get:12 http://ftpmaster.internal/ubuntu impish/main amd64 libmagic-mgc amd64 1:5.39-3 [228 kB] Get:13 http://ftpmaster.internal/ubuntu impish/main amd64 libmagic1 amd64 1:5.39-3 [80.6 kB] Get:14 http://ftpmaster.internal/ubuntu impish/main amd64 file amd64 1:5.39-3 [23.7 kB] Get:15 http://ftpmaster.internal/ubuntu impish/main amd64 gettext-base amd64 0.21-4ubuntu3 [36.6 kB] Get:16 http://ftpmaster.internal/ubuntu impish/main amd64 libpsl5 amd64 0.21.0-1.2 [53.5 kB] Get:17 http://ftpmaster.internal/ubuntu impish/main amd64 libuv1 amd64 1.40.0-2ubuntu1 [90.9 kB] Get:18 http://ftpmaster.internal/ubuntu impish/main amd64 libsigsegv2 amd64 2.13-1ubuntu1 [14.2 kB] Get:19 http://ftpmaster.internal/ubuntu impish/main amd64 m4 amd64 1.4.18-5ubuntu1 [199 kB] Get:20 http://ftpmaster.internal/ubuntu impish/main amd64 autoconf all 2.69-14 [293 kB] Get:21 http://ftpmaster.internal/ubuntu impish/main amd64 autotools-dev all 20180224.1+nmu1 [39.4 kB] Get:22 http://ftpmaster.internal/ubuntu impish/main amd64 automake all 1:1.16.4-2 [557 kB] Get:23 http://ftpmaster.internal/ubuntu impish/main amd64 autopoint all 0.21-4ubuntu3 [422 kB] Get:24 http://ftpmaster.internal/ubuntu impish/main amd64 libdebhelper-perl all 13.3.4ubuntu2 [62.5 kB] Get:25 http://ftpmaster.internal/ubuntu impish/main amd64 libtool all 2.4.6-15 [161 kB] Get:26 http://ftpmaster.internal/ubuntu impish/main amd64 dh-autoreconf all 20 [16.1 kB] Get:27 http://ftpmaster.internal/ubuntu impish/main amd64 libarchive-zip-perl all 1.68-1 [90.2 kB] Get:28 http://ftpmaster.internal/ubuntu impish/main amd64 libsub-override-perl all 0.09-2 [9532 B] Get:29 http://ftpmaster.internal/ubuntu impish/main amd64 libfile-stripnondeterminism-perl all 1.12.0-1 [17.5 kB] Get:30 http://ftpmaster.internal/ubuntu impish/main amd64 dh-strip-nondeterminism all 1.12.0-1 [5228 B] Get:31 http://ftpmaster.internal/ubuntu impish/main amd64 libdw1 amd64 0.185-1 [225 kB] Get:32 http://ftpmaster.internal/ubuntu impish/main amd64 debugedit amd64 1:5.0-0ubuntu2 [47.9 kB] Get:33 http://ftpmaster.internal/ubuntu impish/main amd64 dwz amd64 0.14-1 [98.1 kB] Get:34 http://ftpmaster.internal/ubuntu impish/main amd64 gettext amd64 0.21-4ubuntu3 [824 kB] Get:35 http://ftpmaster.internal/ubuntu impish/main amd64 intltool-debian all 0.35.0+20060710.5 [24.9 kB] Get:36 http://ftpmaster.internal/ubuntu impish/main amd64 po-debconf all 1.0.21+nmu1 [233 kB] Get:37 http://ftpmaster.internal/ubuntu impish/main amd64 debhelper all 13.3.4ubuntu2 [921 kB] Get:38 http://ftpmaster.internal/ubuntu impish/main amd64 fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] Get:39 http://ftpmaster.internal/ubuntu impish/universe amd64 help2man amd64 1.48.4 [139 kB] Get:40 http://ftpmaster.internal/ubuntu impish/main amd64 icu-devtools amd64 67.1-7ubuntu1 [194 kB] Get:41 http://ftpmaster.internal/ubuntu impish/main amd64 libboost1.74-dev amd64 1.74.0-8ubuntu6 [9607 kB] Get:42 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-chrono1.74.0 amd64 1.74.0-8ubuntu6 [232 kB] Get:43 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-chrono1.74-dev amd64 1.74.0-8ubuntu6 [238 kB] Get:44 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-chrono-dev amd64 1.74.0.3ubuntu5 [3964 B] Get:45 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-filesystem1.74.0 amd64 1.74.0-8ubuntu6 [264 kB] Get:46 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-system1.74.0 amd64 1.74.0-8ubuntu6 [221 kB] Get:47 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-system1.74-dev amd64 1.74.0-8ubuntu6 [218 kB] Get:48 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-filesystem1.74-dev amd64 1.74.0-8ubuntu6 [287 kB] Get:49 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-filesystem-dev amd64 1.74.0.3ubuntu5 [3368 B] Get:50 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-regex1.74.0 amd64 1.74.0-8ubuntu6 [511 kB] Get:51 http://ftpmaster.internal/ubuntu impish/main amd64 libicu-dev amd64 67.1-7ubuntu1 [11.1 MB] Get:52 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-regex1.74-dev amd64 1.74.0-8ubuntu6 [596 kB] Get:53 http://ftpmaster.internal/ubuntu impish/main amd64 libboost-iostreams1.74.0 amd64 1.74.0-8ubuntu6 [244 kB] Get:54 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-iostreams1.74-dev amd64 1.74.0-8ubuntu6 [252 kB] Get:55 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-iostreams-dev amd64 1.74.0.3ubuntu5 [3320 B] Get:56 http://ftpmaster.internal/ubuntu impish/universe amd64 libboost-system-dev amd64 1.74.0.3ubuntu5 [3484 B] Get:57 http://ftpmaster.internal/ubuntu impish/main amd64 libbrotli1 amd64 1.0.9-2build2 [274 kB] Get:58 http://ftpmaster.internal/ubuntu impish/main amd64 libsasl2-modules-db amd64 2.1.27+dfsg-2.1build1 [14.6 kB] Get:59 http://ftpmaster.internal/ubuntu impish/main amd64 libsasl2-2 amd64 2.1.27+dfsg-2.1build1 [46.1 kB] Get:60 http://ftpmaster.internal/ubuntu impish/main amd64 libldap-2.5-0 amd64 2.5.6+dfsg-1~exp1ubuntu1 [186 kB] Get:61 http://ftpmaster.internal/ubuntu impish/main amd64 libnghttp2-14 amd64 1.43.0-1 [72.5 kB] Get:62 http://ftpmaster.internal/ubuntu impish/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2build2 [55.0 kB] Get:63 http://ftpmaster.internal/ubuntu impish/main amd64 libssh-4 amd64 0.9.6-1 [185 kB] Get:64 http://ftpmaster.internal/ubuntu impish/main amd64 libcurl3-gnutls amd64 7.74.0-1.3ubuntu2 [268 kB] Get:65 http://ftpmaster.internal/ubuntu impish/main amd64 libcurl4-gnutls-dev amd64 7.74.0-1.3ubuntu2 [361 kB] Get:66 http://ftpmaster.internal/ubuntu impish/main amd64 libdeflate0 amd64 1.7-2ubuntu2 [56.3 kB] Get:67 http://ftpmaster.internal/ubuntu impish/main amd64 libdeflate-dev amd64 1.7-2ubuntu2 [48.2 kB] Get:68 http://ftpmaster.internal/ubuntu impish/universe amd64 libhtscodecs2 amd64 1.1.1-2 [53.1 kB] Get:69 http://ftpmaster.internal/ubuntu impish/universe amd64 libhts3 amd64 1.13+ds-2 [390 kB] Get:70 http://ftpmaster.internal/ubuntu impish/main amd64 liblzma-dev amd64 5.2.5-2 [151 kB] Get:71 http://ftpmaster.internal/ubuntu impish/main amd64 zlib1g-dev amd64 1:1.2.11.dfsg-2ubuntu7 [164 kB] Get:72 http://ftpmaster.internal/ubuntu impish/universe amd64 libhts-dev amd64 1.13+ds-2 [5602 kB] Get:73 http://ftpmaster.internal/ubuntu impish/main amd64 libjs-jquery all 3.5.1+dfsg+~3.5.5-7 [314 kB] Get:74 http://ftpmaster.internal/ubuntu impish/universe amd64 libjs-jquery-datatables all 1.10.21+dfsg-2 [137 kB] Get:75 http://ftpmaster.internal/ubuntu impish/universe amd64 libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] Get:76 http://ftpmaster.internal/ubuntu impish/main amd64 libncurses-dev amd64 6.2+20201114-2build1 [344 kB] Get:77 http://ftpmaster.internal/ubuntu impish/main amd64 libncurses5-dev amd64 6.2+20201114-2build1 [996 B] Get:78 http://ftpmaster.internal/ubuntu impish/main amd64 libc-ares2 amd64 1.17.1-1ubuntu1 [44.5 kB] Get:79 http://ftpmaster.internal/ubuntu impish/universe amd64 libnode72 amd64 12.22.5~dfsg-5ubuntu1 [9300 kB] Get:80 http://ftpmaster.internal/ubuntu impish/universe amd64 nodejs amd64 12.22.5~dfsg-5ubuntu1 [122 kB] Get:81 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-array all 1.2.4-3 [19.2 kB] Get:82 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-axis all 1.0.12-3 [10.2 kB] Get:83 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-dispatch all 1.0.6-2 [7896 B] Get:84 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-selection all 1.4.0-6 [30.8 kB] Get:85 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-drag all 1.2.5-2 [13.9 kB] Get:86 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-color all 1.2.8-2 [15.1 kB] Get:87 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-interpolate all 1.4.0-2 [18.5 kB] Get:88 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-ease all 1.0.5-3 [9972 B] Get:89 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-timer all 1.0.10-1 [8652 B] Get:90 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-transition all 1.3.2-3 [22.2 kB] Get:91 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-brush all 1.1.5-2 [177 kB] Get:92 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-path all 1.0.9-2 [8256 B] Get:93 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-chord all 1.0.6-3 [10.1 kB] Get:94 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-collection all 1.0.7-3 [11.8 kB] Get:95 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-contour all 1.3.2-4 [13.7 kB] Get:96 http://ftpmaster.internal/ubuntu impish/universe amd64 node-iconv-lite all 0.5.1-3 [126 kB] Get:97 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-queue all 3.0.7-11 [9868 B] Get:98 http://ftpmaster.internal/ubuntu impish/universe amd64 node-rw all 1.3.3-2 [7136 B] Get:99 http://ftpmaster.internal/ubuntu impish/universe amd64 node-commander all 6.2.1-2 [32.7 kB] Get:100 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-dsv all 1.1.1-5 [14.5 kB] Get:101 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-fetch all 1.2.0-1 [7384 B] Get:102 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-quadtree all 1.0.7-2 [13.1 kB] Get:103 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-force all 1.2.1-2 [363 kB] Get:104 http://ftpmaster.internal/ubuntu impish/universe amd64 libjs-d3-format all 1:1.4.1-3 [17.0 kB] Get:105 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-format all 1:1.4.1-3 [7592 B] Get:106 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-geo all 1.11.9-4 [53.6 kB] Get:107 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-hierarchy all 1.1.8-3 [28.6 kB] Get:108 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-polygon all 1.0.5-3 [7432 B] Get:109 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-random all 1.1.2-3 [7224 B] Get:110 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-time all 1.0.11-4 [14.6 kB] Get:111 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-time-format all 2.1.3-3 [18.9 kB] Get:112 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-scale all 2.2.2-3 [31.4 kB] Get:113 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-scale-chromatic all 1.5.0-2 [18.5 kB] Get:114 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-shape all 1.3.7-2 [40.5 kB] Get:115 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-voronoi all 1.1.4-3 [17.2 kB] Get:116 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3-zoom all 1.8.3-2 [20.2 kB] Get:117 http://ftpmaster.internal/ubuntu impish/universe amd64 node-d3 all 5.16.0-4 [171 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 62.9 MB in 4s (14.6 MB/s) Selecting previously unselected package liblocale-gettext-perl. (Reading database ... 15067 files and directories currently installed.) Preparing to unpack .../000-liblocale-gettext-perl_1.07-4build1_amd64.deb ... Unpacking liblocale-gettext-perl (1.07-4build1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../001-bsdextrautils_2.36.1-8ubuntu1_amd64.deb ... Unpacking bsdextrautils (2.36.1-8ubuntu1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../002-libuchardet0_0.0.7-1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../003-groff-base_1.22.4-7_amd64.deb ... Unpacking groff-base (1.22.4-7) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../004-libpipeline1_1.5.3-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../005-man-db_2.9.4-2_amd64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../006-node-normalize.css_8.0.1-3_all.deb ... Unpacking node-normalize.css (8.0.1-3) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../007-libelf1_0.185-1_amd64.deb ... Unpacking libelf1:amd64 (0.185-1) ... Selecting previously unselected package libicu67:amd64. Preparing to unpack .../008-libicu67_67.1-7ubuntu1_amd64.deb ... Unpacking libicu67:amd64 (67.1-7ubuntu1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../009-libxml2_2.9.12+dfsg-4_amd64.deb ... Unpacking libxml2:amd64 (2.9.12+dfsg-4) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../010-libmagic-mgc_1%3a5.39-3_amd64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../011-libmagic1_1%3a5.39-3_amd64.deb ... Unpacking libmagic1:amd64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../012-file_1%3a5.39-3_amd64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../013-gettext-base_0.21-4ubuntu3_amd64.deb ... Unpacking gettext-base (0.21-4ubuntu3) ... Selecting previously unselected package libpsl5:amd64. Preparing to unpack .../014-libpsl5_0.21.0-1.2_amd64.deb ... Unpacking libpsl5:amd64 (0.21.0-1.2) ... Selecting previously unselected package libuv1:amd64. Preparing to unpack .../015-libuv1_1.40.0-2ubuntu1_amd64.deb ... Unpacking libuv1:amd64 (1.40.0-2ubuntu1) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../016-libsigsegv2_2.13-1ubuntu1_amd64.deb ... Unpacking libsigsegv2:amd64 (2.13-1ubuntu1) ... Selecting previously unselected package m4. Preparing to unpack .../017-m4_1.4.18-5ubuntu1_amd64.deb ... Unpacking m4 (1.4.18-5ubuntu1) ... Selecting previously unselected package autoconf. Preparing to unpack .../018-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../019-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../020-automake_1%3a1.16.4-2_all.deb ... Unpacking automake (1:1.16.4-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../021-autopoint_0.21-4ubuntu3_all.deb ... Unpacking autopoint (0.21-4ubuntu3) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../022-libdebhelper-perl_13.3.4ubuntu2_all.deb ... Unpacking libdebhelper-perl (13.3.4ubuntu2) ... Selecting previously unselected package libtool. Preparing to unpack .../023-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../024-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../025-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../026-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../027-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../028-dh-strip-nondeterminism_1.12.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.12.0-1) ... Selecting previously unselected package libdw1:amd64. Preparing to unpack .../029-libdw1_0.185-1_amd64.deb ... Unpacking libdw1:amd64 (0.185-1) ... Selecting previously unselected package debugedit. Preparing to unpack .../030-debugedit_1%3a5.0-0ubuntu2_amd64.deb ... Unpacking debugedit (1:5.0-0ubuntu2) ... Selecting previously unselected package dwz. Preparing to unpack .../031-dwz_0.14-1_amd64.deb ... Unpacking dwz (0.14-1) ... Selecting previously unselected package gettext. Preparing to unpack .../032-gettext_0.21-4ubuntu3_amd64.deb ... Unpacking gettext (0.21-4ubuntu3) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../033-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../034-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../035-debhelper_13.3.4ubuntu2_all.deb ... Unpacking debhelper (13.3.4ubuntu2) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../036-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Selecting previously unselected package help2man. Preparing to unpack .../037-help2man_1.48.4_amd64.deb ... Unpacking help2man (1.48.4) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../038-icu-devtools_67.1-7ubuntu1_amd64.deb ... Unpacking icu-devtools (67.1-7ubuntu1) ... Selecting previously unselected package libboost1.74-dev:amd64. Preparing to unpack .../039-libboost1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-chrono1.74.0:amd64. Preparing to unpack .../040-libboost-chrono1.74.0_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-chrono1.74.0:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-chrono1.74-dev:amd64. Preparing to unpack .../041-libboost-chrono1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-chrono1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-chrono-dev:amd64. Preparing to unpack .../042-libboost-chrono-dev_1.74.0.3ubuntu5_amd64.deb ... Unpacking libboost-chrono-dev:amd64 (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-filesystem1.74.0:amd64. Preparing to unpack .../043-libboost-filesystem1.74.0_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-filesystem1.74.0:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-system1.74.0:amd64. Preparing to unpack .../044-libboost-system1.74.0_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-system1.74.0:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-system1.74-dev:amd64. Preparing to unpack .../045-libboost-system1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-system1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-filesystem1.74-dev:amd64. Preparing to unpack .../046-libboost-filesystem1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-filesystem1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-filesystem-dev:amd64. Preparing to unpack .../047-libboost-filesystem-dev_1.74.0.3ubuntu5_amd64.deb ... Unpacking libboost-filesystem-dev:amd64 (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-regex1.74.0:amd64. Preparing to unpack .../048-libboost-regex1.74.0_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-regex1.74.0:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libicu-dev:amd64. Preparing to unpack .../049-libicu-dev_67.1-7ubuntu1_amd64.deb ... Unpacking libicu-dev:amd64 (67.1-7ubuntu1) ... Selecting previously unselected package libboost-regex1.74-dev:amd64. Preparing to unpack .../050-libboost-regex1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-regex1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-iostreams1.74.0:amd64. Preparing to unpack .../051-libboost-iostreams1.74.0_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-iostreams1.74.0:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-iostreams1.74-dev:amd64. Preparing to unpack .../052-libboost-iostreams1.74-dev_1.74.0-8ubuntu6_amd64.deb ... Unpacking libboost-iostreams1.74-dev:amd64 (1.74.0-8ubuntu6) ... Selecting previously unselected package libboost-iostreams-dev:amd64. Preparing to unpack .../053-libboost-iostreams-dev_1.74.0.3ubuntu5_amd64.deb ... Unpacking libboost-iostreams-dev:amd64 (1.74.0.3ubuntu5) ... Selecting previously unselected package libboost-system-dev:amd64. Preparing to unpack .../054-libboost-system-dev_1.74.0.3ubuntu5_amd64.deb ... Unpacking libboost-system-dev:amd64 (1.74.0.3ubuntu5) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../055-libbrotli1_1.0.9-2build2_amd64.deb ... Unpacking libbrotli1:amd64 (1.0.9-2build2) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../056-libsasl2-modules-db_2.1.27+dfsg-2.1build1_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.27+dfsg-2.1build1) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../057-libsasl2-2_2.1.27+dfsg-2.1build1_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.27+dfsg-2.1build1) ... Selecting previously unselected package libldap-2.5-0:amd64. Preparing to unpack .../058-libldap-2.5-0_2.5.6+dfsg-1~exp1ubuntu1_amd64.deb ... Unpacking libldap-2.5-0:amd64 (2.5.6+dfsg-1~exp1ubuntu1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../059-libnghttp2-14_1.43.0-1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.43.0-1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../060-librtmp1_2.4+20151223.gitfa8646d.1-2build2_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2build2) ... Selecting previously unselected package libssh-4:amd64. Preparing to unpack .../061-libssh-4_0.9.6-1_amd64.deb ... Unpacking libssh-4:amd64 (0.9.6-1) ... Selecting previously unselected package libcurl3-gnutls:amd64. Preparing to unpack .../062-libcurl3-gnutls_7.74.0-1.3ubuntu2_amd64.deb ... Unpacking libcurl3-gnutls:amd64 (7.74.0-1.3ubuntu2) ... Selecting previously unselected package libcurl4-gnutls-dev:amd64. Preparing to unpack .../063-libcurl4-gnutls-dev_7.74.0-1.3ubuntu2_amd64.deb ... Unpacking libcurl4-gnutls-dev:amd64 (7.74.0-1.3ubuntu2) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../064-libdeflate0_1.7-2ubuntu2_amd64.deb ... Unpacking libdeflate0:amd64 (1.7-2ubuntu2) ... Selecting previously unselected package libdeflate-dev:amd64. Preparing to unpack .../065-libdeflate-dev_1.7-2ubuntu2_amd64.deb ... Unpacking libdeflate-dev:amd64 (1.7-2ubuntu2) ... Selecting previously unselected package libhtscodecs2:amd64. Preparing to unpack .../066-libhtscodecs2_1.1.1-2_amd64.deb ... Unpacking libhtscodecs2:amd64 (1.1.1-2) ... Selecting previously unselected package libhts3:amd64. Preparing to unpack .../067-libhts3_1.13+ds-2_amd64.deb ... Unpacking libhts3:amd64 (1.13+ds-2) ... Selecting previously unselected package liblzma-dev:amd64. Preparing to unpack .../068-liblzma-dev_5.2.5-2_amd64.deb ... Unpacking liblzma-dev:amd64 (5.2.5-2) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../069-zlib1g-dev_1%3a1.2.11.dfsg-2ubuntu7_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.2.11.dfsg-2ubuntu7) ... Selecting previously unselected package libhts-dev:amd64. Preparing to unpack .../070-libhts-dev_1.13+ds-2_amd64.deb ... Unpacking libhts-dev:amd64 (1.13+ds-2) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../071-libjs-jquery_3.5.1+dfsg+~3.5.5-7_all.deb ... Unpacking libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../072-libjs-jquery-datatables_1.10.21+dfsg-2_all.deb ... Unpacking libjs-jquery-datatables (1.10.21+dfsg-2) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../073-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Selecting previously unselected package libncurses-dev:amd64. Preparing to unpack .../074-libncurses-dev_6.2+20201114-2build1_amd64.deb ... Unpacking libncurses-dev:amd64 (6.2+20201114-2build1) ... Selecting previously unselected package libncurses5-dev:amd64. Preparing to unpack .../075-libncurses5-dev_6.2+20201114-2build1_amd64.deb ... Unpacking libncurses5-dev:amd64 (6.2+20201114-2build1) ... Selecting previously unselected package libc-ares2:amd64. Preparing to unpack .../076-libc-ares2_1.17.1-1ubuntu1_amd64.deb ... Unpacking libc-ares2:amd64 (1.17.1-1ubuntu1) ... Selecting previously unselected package libnode72:amd64. Preparing to unpack .../077-libnode72_12.22.5~dfsg-5ubuntu1_amd64.deb ... Unpacking libnode72:amd64 (12.22.5~dfsg-5ubuntu1) ... Selecting previously unselected package nodejs. Preparing to unpack .../078-nodejs_12.22.5~dfsg-5ubuntu1_amd64.deb ... Unpacking nodejs (12.22.5~dfsg-5ubuntu1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../079-node-d3-array_1.2.4-3_all.deb ... Unpacking node-d3-array (1.2.4-3) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../080-node-d3-axis_1.0.12-3_all.deb ... Unpacking node-d3-axis (1.0.12-3) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../081-node-d3-dispatch_1.0.6-2_all.deb ... Unpacking node-d3-dispatch (1.0.6-2) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../082-node-d3-selection_1.4.0-6_all.deb ... Unpacking node-d3-selection (1.4.0-6) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../083-node-d3-drag_1.2.5-2_all.deb ... Unpacking node-d3-drag (1.2.5-2) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../084-node-d3-color_1.2.8-2_all.deb ... Unpacking node-d3-color (1.2.8-2) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../085-node-d3-interpolate_1.4.0-2_all.deb ... Unpacking node-d3-interpolate (1.4.0-2) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../086-node-d3-ease_1.0.5-3_all.deb ... Unpacking node-d3-ease (1.0.5-3) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../087-node-d3-timer_1.0.10-1_all.deb ... Unpacking node-d3-timer (1.0.10-1) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../088-node-d3-transition_1.3.2-3_all.deb ... Unpacking node-d3-transition (1.3.2-3) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../089-node-d3-brush_1.1.5-2_all.deb ... Unpacking node-d3-brush (1.1.5-2) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../090-node-d3-path_1.0.9-2_all.deb ... Unpacking node-d3-path (1.0.9-2) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../091-node-d3-chord_1.0.6-3_all.deb ... Unpacking node-d3-chord (1.0.6-3) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../092-node-d3-collection_1.0.7-3_all.deb ... Unpacking node-d3-collection (1.0.7-3) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../093-node-d3-contour_1.3.2-4_all.deb ... Unpacking node-d3-contour (1.3.2-4) ... Selecting previously unselected package node-iconv-lite. Preparing to unpack .../094-node-iconv-lite_0.5.1-3_all.deb ... Unpacking node-iconv-lite (0.5.1-3) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../095-node-d3-queue_3.0.7-11_all.deb ... Unpacking node-d3-queue (3.0.7-11) ... Selecting previously unselected package node-rw. Preparing to unpack .../096-node-rw_1.3.3-2_all.deb ... Unpacking node-rw (1.3.3-2) ... Selecting previously unselected package node-commander. Preparing to unpack .../097-node-commander_6.2.1-2_all.deb ... Unpacking node-commander (6.2.1-2) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../098-node-d3-dsv_1.1.1-5_all.deb ... Unpacking node-d3-dsv (1.1.1-5) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../099-node-d3-fetch_1.2.0-1_all.deb ... Unpacking node-d3-fetch (1.2.0-1) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../100-node-d3-quadtree_1.0.7-2_all.deb ... Unpacking node-d3-quadtree (1.0.7-2) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../101-node-d3-force_1.2.1-2_all.deb ... Unpacking node-d3-force (1.2.1-2) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../102-libjs-d3-format_1%3a1.4.1-3_all.deb ... Unpacking libjs-d3-format (1:1.4.1-3) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../103-node-d3-format_1%3a1.4.1-3_all.deb ... Unpacking node-d3-format (1:1.4.1-3) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../104-node-d3-geo_1.11.9-4_all.deb ... Unpacking node-d3-geo (1.11.9-4) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../105-node-d3-hierarchy_1.1.8-3_all.deb ... Unpacking node-d3-hierarchy (1.1.8-3) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../106-node-d3-polygon_1.0.5-3_all.deb ... Unpacking node-d3-polygon (1.0.5-3) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../107-node-d3-random_1.1.2-3_all.deb ... Unpacking node-d3-random (1.1.2-3) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../108-node-d3-time_1.0.11-4_all.deb ... Unpacking node-d3-time (1.0.11-4) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../109-node-d3-time-format_2.1.3-3_all.deb ... Unpacking node-d3-time-format (2.1.3-3) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../110-node-d3-scale_2.2.2-3_all.deb ... Unpacking node-d3-scale (2.2.2-3) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../111-node-d3-scale-chromatic_1.5.0-2_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0-2) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../112-node-d3-shape_1.3.7-2_all.deb ... Unpacking node-d3-shape (1.3.7-2) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../113-node-d3-voronoi_1.1.4-3_all.deb ... Unpacking node-d3-voronoi (1.1.4-3) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../114-node-d3-zoom_1.8.3-2_all.deb ... Unpacking node-d3-zoom (1.8.3-2) ... Selecting previously unselected package node-d3. Preparing to unpack .../115-node-d3_5.16.0-4_all.deb ... Unpacking node-d3 (5.16.0-4) ... Selecting previously unselected package sbuild-build-depends-ataqv-dummy. Preparing to unpack .../116-sbuild-build-depends-ataqv-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Setting up libhtscodecs2:amd64 (1.1.1-2) ... Setting up libboost-chrono1.74.0:amd64 (1.74.0-8ubuntu6) ... Setting up libpipeline1:amd64 (1.5.3-1) ... Setting up libboost-system1.74.0:amd64 (1.74.0-8ubuntu6) ... Setting up libncurses-dev:amd64 (6.2+20201114-2build1) ... Setting up libpsl5:amd64 (0.21.0-1.2) ... Setting up libboost1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up bsdextrautils (2.36.1-8ubuntu1) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:amd64 (67.1-7ubuntu1) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libboost-iostreams1.74.0:amd64 (1.74.0-8ubuntu6) ... Setting up libdebhelper-perl (13.3.4ubuntu2) ... Setting up libbrotli1:amd64 (1.0.9-2build2) ... Setting up libboost-chrono1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up libnghttp2-14:amd64 (1.43.0-1) ... Setting up libmagic1:amd64 (1:5.39-3) ... Setting up libdeflate0:amd64 (1.7-2ubuntu2) ... Setting up gettext-base (0.21-4ubuntu3) ... Setting up libboost-filesystem1.74.0:amd64 (1.74.0-8ubuntu6) ... Setting up libc-ares2:amd64 (1.17.1-1ubuntu1) ... Setting up file (1:5.39-3) ... Setting up libsasl2-modules-db:amd64 (2.1.27+dfsg-2.1build1) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libuv1:amd64 (1.40.0-2ubuntu1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2build2) ... Setting up libboost-system1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up libsigsegv2:amd64 (2.13-1ubuntu1) ... Setting up libboost-regex1.74.0:amd64 (1.74.0-8ubuntu6) ... Setting up autopoint (0.21-4ubuntu3) ... Setting up icu-devtools (67.1-7ubuntu1) ... Setting up libsasl2-2:amd64 (2.1.27+dfsg-2.1build1) ... Setting up libssh-4:amd64 (0.9.6-1) ... Setting up liblzma-dev:amd64 (5.2.5-2) ... Setting up zlib1g-dev:amd64 (1:1.2.11.dfsg-2ubuntu7) ... Setting up libjs-d3-format (1:1.4.1-3) ... Setting up libuchardet0:amd64 (0.0.7-1) ... Setting up libncurses5-dev:amd64 (6.2+20201114-2build1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libboost-filesystem1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Setting up libdeflate-dev:amd64 (1.7-2ubuntu2) ... Setting up node-normalize.css (8.0.1-3) ... Setting up libelf1:amd64 (0.185-1) ... Setting up libicu-dev:amd64 (67.1-7ubuntu1) ... Setting up libxml2:amd64 (2.9.12+dfsg-4) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Setting up libboost-filesystem-dev:amd64 (1.74.0.3ubuntu5) ... Setting up liblocale-gettext-perl (1.07-4build1) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Setting up libfile-stripnondeterminism-perl (1.12.0-1) ... Setting up libdw1:amd64 (0.185-1) ... Setting up gettext (0.21-4ubuntu3) ... Setting up libtool (2.4.6-15) ... Setting up libboost-chrono-dev:amd64 (1.74.0.3ubuntu5) ... Setting up libboost-system-dev:amd64 (1.74.0.3ubuntu5) ... Setting up m4 (1.4.18-5ubuntu1) ... Setting up libldap-2.5-0:amd64 (2.5.6+dfsg-1~exp1ubuntu1) ... Setting up libnode72:amd64 (12.22.5~dfsg-5ubuntu1) ... Setting up libjs-jquery-datatables (1.10.21+dfsg-2) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up help2man (1.48.4) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.12.0-1) ... Setting up dwz (0.14-1) ... Setting up libboost-regex1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up groff-base (1.22.4-7) ... Setting up debugedit (1:5.0-0ubuntu2) ... Setting up automake (1:1.16.4-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up po-debconf (1.0.21+nmu1) ... Setting up libcurl3-gnutls:amd64 (7.74.0-1.3ubuntu2) ... Setting up libcurl4-gnutls-dev:amd64 (7.74.0-1.3ubuntu2) ... Setting up nodejs (12.22.5~dfsg-5ubuntu1) ... update-alternatives: using /usr/bin/nodejs to provide /usr/bin/js (js) in auto mode Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /lib/systemd/system/man-db.timer. Setting up node-d3-path (1.0.9-2) ... Setting up libboost-iostreams1.74-dev:amd64 (1.74.0-8ubuntu6) ... Setting up dh-autoreconf (20) ... Setting up node-iconv-lite (0.5.1-3) ... Setting up node-d3-polygon (1.0.5-3) ... Setting up node-d3-quadtree (1.0.7-2) ... Setting up node-d3-collection (1.0.7-3) ... Setting up node-d3-voronoi (1.1.4-3) ... Setting up node-d3-dispatch (1.0.6-2) ... Setting up node-d3-time (1.0.11-4) ... Setting up node-commander (6.2.1-2) ... Setting up node-d3-array (1.2.4-3) ... Setting up node-d3-geo (1.11.9-4) ... Setting up node-d3-random (1.1.2-3) ... Setting up node-d3-timer (1.0.10-1) ... Setting up node-d3-color (1.2.8-2) ... Setting up libhts3:amd64 (1.13+ds-2) ... Setting up node-d3-interpolate (1.4.0-2) ... Setting up node-d3-queue (3.0.7-11) ... Setting up node-d3-format (1:1.4.1-3) ... Setting up node-d3-hierarchy (1.1.8-3) ... Setting up node-d3-ease (1.0.5-3) ... Setting up node-d3-time-format (2.1.3-3) ... Setting up node-d3-scale-chromatic (1.5.0-2) ... Setting up node-d3-chord (1.0.6-3) ... Setting up libhts-dev:amd64 (1.13+ds-2) ... Setting up debhelper (13.3.4ubuntu2) ... Setting up node-d3-selection (1.4.0-6) ... Setting up node-d3-axis (1.0.12-3) ... Setting up libboost-iostreams-dev:amd64 (1.74.0.3ubuntu5) ... Setting up node-d3-shape (1.3.7-2) ... Setting up node-d3-drag (1.2.5-2) ... Setting up node-rw (1.3.3-2) ... Setting up node-d3-scale (2.2.2-3) ... Setting up node-d3-force (1.2.1-2) ... Setting up node-d3-contour (1.3.2-4) ... Setting up node-d3-dsv (1.1.1-5) ... Setting up node-d3-transition (1.3.2-3) ... Setting up node-d3-zoom (1.8.3-2) ... Setting up node-d3-fetch (1.2.0-1) ... Setting up node-d3-brush (1.1.5-2) ... Setting up node-d3 (5.16.0-4) ... Setting up sbuild-build-depends-ataqv-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.34-0ubuntu2) ... +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 4.15.0-158-generic amd64 (x86_64) Toolchain package versions: binutils_2.37-7ubuntu1 dpkg-dev_1.20.9ubuntu13 g++-10_10.3.0-11ubuntu1 g++-11_11.2.0-7ubuntu2 gcc-10_10.3.0-11ubuntu1 gcc-11_11.2.0-7ubuntu2 libc6-dev_2.34-0ubuntu2 libstdc++-10-dev_10.3.0-11ubuntu1 libstdc++-11-dev_11.2.0-7ubuntu2 libstdc++6_11.2.0-7ubuntu2 linux-libc-dev_5.13.0-16.16 Package versions: adduser_3.118ubuntu5 advancecomp_2.1-2.1ubuntu1 apt_2.3.9 autoconf_2.69-14 automake_1:1.16.4-2 autopoint_0.21-4ubuntu3 autotools-dev_20180224.1+nmu1 base-files_11.1ubuntu3 base-passwd_3.5.51 bash_5.1-3ubuntu1 binutils_2.37-7ubuntu1 binutils-common_2.37-7ubuntu1 binutils-x86-64-linux-gnu_2.37-7ubuntu1 bsdextrautils_2.36.1-8ubuntu1 bsdutils_1:2.36.1-8ubuntu1 build-essential_12.9ubuntu1 bzip2_1.0.8-4ubuntu3 ca-certificates_20210119build1 coreutils_8.32-4ubuntu2 cpp_4:11.2.0-1ubuntu1 cpp-10_10.3.0-11ubuntu1 cpp-11_11.2.0-7ubuntu2 dash_0.5.11+git20210120+802ebd4-1 debconf_1.5.77 debhelper_13.3.4ubuntu2 debianutils_4.11.2 debugedit_1:5.0-0ubuntu2 dh-autoreconf_20 dh-strip-nondeterminism_1.12.0-1 diffutils_1:3.8-0ubuntu1 dpkg_1.20.9ubuntu13 dpkg-dev_1.20.9ubuntu13 dwz_0.14-1 e2fsprogs_1.46.3-1ubuntu3 fakeroot_1.25.3-1.1ubuntu2 file_1:5.39-3 findutils_4.8.0-1ubuntu2 fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1 g++_4:11.2.0-1ubuntu1 g++-10_10.3.0-11ubuntu1 g++-11_11.2.0-7ubuntu2 gcc_4:11.2.0-1ubuntu1 gcc-10_10.3.0-11ubuntu1 gcc-10-base_10.3.0-11ubuntu1 gcc-11_11.2.0-7ubuntu2 gcc-11-base_11.2.0-7ubuntu2 gettext_0.21-4ubuntu3 gettext-base_0.21-4ubuntu3 gpg_2.2.20-1ubuntu4 gpg-agent_2.2.20-1ubuntu4 gpgconf_2.2.20-1ubuntu4 gpgv_2.2.20-1ubuntu4 grep_3.7-0ubuntu1 groff-base_1.22.4-7 gzip_1.10-4ubuntu1 help2man_1.48.4 hostname_3.23 icu-devtools_67.1-7ubuntu1 init_1.60 init-system-helpers_1.60 intltool-debian_0.35.0+20060710.5 libacl1_2.2.53-10ubuntu1 libapparmor1_3.0.3-0ubuntu1 libapt-pkg6.0_2.3.9 libarchive-zip-perl_1.68-1 libargon2-1_0~20171227-0.2build21.04.0 libasan6_11.2.0-7ubuntu2 libassuan0_2.5.5-1 libatomic1_11.2.0-7ubuntu2 libattr1_1:2.4.48-6build1 libaudit-common_1:3.0-2ubuntu2 libaudit1_1:3.0-2ubuntu2 libbinutils_2.37-7ubuntu1 libblkid1_2.36.1-8ubuntu1 libboost-chrono-dev_1.74.0.3ubuntu5 libboost-chrono1.74-dev_1.74.0-8ubuntu6 libboost-chrono1.74.0_1.74.0-8ubuntu6 libboost-filesystem-dev_1.74.0.3ubuntu5 libboost-filesystem1.74-dev_1.74.0-8ubuntu6 libboost-filesystem1.74.0_1.74.0-8ubuntu6 libboost-iostreams-dev_1.74.0.3ubuntu5 libboost-iostreams1.74-dev_1.74.0-8ubuntu6 libboost-iostreams1.74.0_1.74.0-8ubuntu6 libboost-regex1.74-dev_1.74.0-8ubuntu6 libboost-regex1.74.0_1.74.0-8ubuntu6 libboost-system-dev_1.74.0.3ubuntu5 libboost-system1.74-dev_1.74.0-8ubuntu6 libboost-system1.74.0_1.74.0-8ubuntu6 libboost1.74-dev_1.74.0-8ubuntu6 libbrotli1_1.0.9-2build2 libbz2-1.0_1.0.8-4ubuntu3 libc-ares2_1.17.1-1ubuntu1 libc-bin_2.34-0ubuntu2 libc-dev-bin_2.34-0ubuntu2 libc6_2.34-0ubuntu2 libc6-dev_2.34-0ubuntu2 libcap-ng0_0.7.9-2.2build1 libcap2_1:2.44-1build1 libcc1-0_11.2.0-7ubuntu2 libcom-err2_1.46.3-1ubuntu3 libcrypt-dev_1:4.4.18-4ubuntu1 libcrypt1_1:4.4.18-4ubuntu1 libcryptsetup12_2:2.3.6-0ubuntu1 libctf-nobfd0_2.37-7ubuntu1 libctf0_2.37-7ubuntu1 libcurl3-gnutls_7.74.0-1.3ubuntu2 libcurl4-gnutls-dev_7.74.0-1.3ubuntu2 libdb5.3_5.3.28+dfsg1-0.8ubuntu1 libdebconfclient0_0.256ubuntu3 libdebhelper-perl_13.3.4ubuntu2 libdeflate-dev_1.7-2ubuntu2 libdeflate0_1.7-2ubuntu2 libdevmapper1.02.1_2:1.02.175-2.1ubuntu1 libdpkg-perl_1.20.9ubuntu13 libdw1_0.185-1 libelf1_0.185-1 libexpat1_2.4.1-2 libext2fs2_1.46.3-1ubuntu3 libfakeroot_1.25.3-1.1ubuntu2 libffi8_3.4.2-1ubuntu5 libfile-stripnondeterminism-perl_1.12.0-1 libgcc-10-dev_10.3.0-11ubuntu1 libgcc-11-dev_11.2.0-7ubuntu2 libgcc-s1_11.2.0-7ubuntu2 libgcrypt20_1.8.7-5ubuntu2 libgdbm-compat4_1.19-2 libgdbm6_1.19-2 libgmp10_2:6.2.1+dfsg-1ubuntu2 libgnutls30_3.7.1-5ubuntu1 libgomp1_11.2.0-7ubuntu2 libgpg-error0_1.38-2build1 libgssapi-krb5-2_1.18.3-6 libhogweed6_3.7.3-1 libhts-dev_1.13+ds-2 libhts3_1.13+ds-2 libhtscodecs2_1.1.1-2 libicu-dev_67.1-7ubuntu1 libicu67_67.1-7ubuntu1 libidn2-0_2.3.1-1 libip4tc2_1.8.7-1ubuntu2 libisl23_0.24-1 libitm1_11.2.0-7ubuntu2 libjs-d3-format_1:1.4.1-3 libjs-jquery_3.5.1+dfsg+~3.5.5-7 libjs-jquery-datatables_1.10.21+dfsg-2 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5 libjson-c5_0.15-2build2 libk5crypto3_1.18.3-6 libkeyutils1_1.6.1-2ubuntu1 libkmod2_28-1ubuntu4 libkrb5-3_1.18.3-6 libkrb5support0_1.18.3-6 libldap-2.5-0_2.5.6+dfsg-1~exp1ubuntu1 liblocale-gettext-perl_1.07-4build1 liblockfile-bin_1.17-1 liblockfile1_1.17-1 liblsan0_11.2.0-7ubuntu2 liblz4-1_1.9.3-2 liblzma-dev_5.2.5-2 liblzma5_5.2.5-2 libmagic-mgc_1:5.39-3 libmagic1_1:5.39-3 libmount1_2.36.1-8ubuntu1 libmpc3_1.2.0-1build1 libmpdec3_2.5.1-2 libmpfr6_4.1.0-3build1 libncurses-dev_6.2+20201114-2build1 libncurses5-dev_6.2+20201114-2build1 libncurses6_6.2+20201114-2build1 libncursesw6_6.2+20201114-2build1 libnettle8_3.7.3-1 libnghttp2-14_1.43.0-1 libnode72_12.22.5~dfsg-5ubuntu1 libnpth0_1.6-3 libnsl-dev_1.3.0-2 libnsl2_1.3.0-2 libp11-kit0_0.23.22-1build1 libpam-modules_1.3.1-5ubuntu11 libpam-modules-bin_1.3.1-5ubuntu11 libpam-runtime_1.3.1-5ubuntu11 libpam0g_1.3.1-5ubuntu11 libpcre2-8-0_10.37-0ubuntu2 libpcre3_2:8.39-13build3 libperl5.32_5.32.1-3ubuntu3 libpipeline1_1.5.3-1 libpng16-16_1.6.37-3build3 libprocps8_2:3.3.17-5ubuntu3 libpsl5_0.21.0-1.2 libpython3-stdlib_3.9.4-1 libpython3.9-minimal_3.9.7-2build1 libpython3.9-stdlib_3.9.7-2build1 libquadmath0_11.2.0-7ubuntu2 libreadline8_8.1-2 librtmp1_2.4+20151223.gitfa8646d.1-2build2 libsasl2-2_2.1.27+dfsg-2.1build1 libsasl2-modules-db_2.1.27+dfsg-2.1build1 libseccomp2_2.5.1-1ubuntu1 libselinux1_3.1-3build1 libsemanage-common_3.1-1ubuntu1 libsemanage1_3.1-1ubuntu1 libsepol1_3.1-1ubuntu1 libsigsegv2_2.13-1ubuntu1 libsmartcols1_2.36.1-8ubuntu1 libsqlite3-0_3.35.5-1 libss2_1.46.3-1ubuntu3 libssh-4_0.9.6-1 libssl1.1_1.1.1l-1ubuntu1 libstdc++-10-dev_10.3.0-11ubuntu1 libstdc++-11-dev_11.2.0-7ubuntu2 libstdc++6_11.2.0-7ubuntu2 libsub-override-perl_0.09-2 libsystemd0_248.3-1ubuntu7 libtasn1-6_4.16.0-2 libtinfo6_6.2+20201114-2build1 libtirpc-common_1.3.2-2 libtirpc-dev_1.3.2-2 libtirpc3_1.3.2-2 libtool_2.4.6-15 libtsan0_11.2.0-7ubuntu2 libubsan1_11.2.0-7ubuntu2 libuchardet0_0.0.7-1 libudev1_248.3-1ubuntu7 libunistring2_0.9.10-6 libuuid1_2.36.1-8ubuntu1 libuv1_1.40.0-2ubuntu1 libxml2_2.9.12+dfsg-4 libxxhash0_0.8.0-2 libzstd1_1.4.8+dfsg-2.1 linux-libc-dev_5.13.0-16.16 lockfile-progs_0.1.18 login_1:4.8.1-1ubuntu9 logsave_1.46.3-1ubuntu3 lsb-base_11.1.0ubuntu2 lto-disabled-list_16 m4_1.4.18-5ubuntu1 make_4.3-4ubuntu1 man-db_2.9.4-2 mawk_1.3.4.20200120-2 media-types_4.0.0 mount_2.36.1-8ubuntu1 ncurses-base_6.2+20201114-2build1 ncurses-bin_6.2+20201114-2build1 node-commander_6.2.1-2 node-d3_5.16.0-4 node-d3-array_1.2.4-3 node-d3-axis_1.0.12-3 node-d3-brush_1.1.5-2 node-d3-chord_1.0.6-3 node-d3-collection_1.0.7-3 node-d3-color_1.2.8-2 node-d3-contour_1.3.2-4 node-d3-dispatch_1.0.6-2 node-d3-drag_1.2.5-2 node-d3-dsv_1.1.1-5 node-d3-ease_1.0.5-3 node-d3-fetch_1.2.0-1 node-d3-force_1.2.1-2 node-d3-format_1:1.4.1-3 node-d3-geo_1.11.9-4 node-d3-hierarchy_1.1.8-3 node-d3-interpolate_1.4.0-2 node-d3-path_1.0.9-2 node-d3-polygon_1.0.5-3 node-d3-quadtree_1.0.7-2 node-d3-queue_3.0.7-11 node-d3-random_1.1.2-3 node-d3-scale_2.2.2-3 node-d3-scale-chromatic_1.5.0-2 node-d3-selection_1.4.0-6 node-d3-shape_1.3.7-2 node-d3-time_1.0.11-4 node-d3-time-format_2.1.3-3 node-d3-timer_1.0.10-1 node-d3-transition_1.3.2-3 node-d3-voronoi_1.1.4-3 node-d3-zoom_1.8.3-2 node-iconv-lite_0.5.1-3 node-normalize.css_8.0.1-3 node-rw_1.3.3-2 nodejs_12.22.5~dfsg-5ubuntu1 openssl_1.1.1l-1ubuntu1 optipng_0.7.7-1 passwd_1:4.8.1-1ubuntu9 patch_2.7.6-7 perl_5.32.1-3ubuntu3 perl-base_5.32.1-3ubuntu3 perl-modules-5.32_5.32.1-3ubuntu3 pinentry-curses_1.1.1-1 pkgbinarymangler_148 po-debconf_1.0.21+nmu1 policyrcd-script-zg2_0.1-3 procps_2:3.3.17-5ubuntu3 python3_3.9.4-1 python3-minimal_3.9.4-1 python3-psutil_5.8.0-1 python3.9_3.9.7-2build1 python3.9-minimal_3.9.7-2build1 readline-common_8.1-2 rpcsvc-proto_1.4.2-0ubuntu4 sbuild-build-depends-ataqv-dummy_0.invalid.0 sbuild-build-depends-core-dummy_0.invalid.0 sed_4.7-1ubuntu1 sensible-utils_0.0.14 systemd_248.3-1ubuntu7 systemd-sysv_248.3-1ubuntu7 systemd-timesyncd_248.3-1ubuntu7 sysvinit-utils_2.96-7ubuntu1 tar_1.34+dfsg-1build1 tzdata_2021a-1ubuntu1 ubuntu-keyring_2021.03.26 usrmerge_25ubuntu1 util-linux_2.36.1-8ubuntu1 xz-utils_5.2.5-2 zlib1g_1:1.2.11.dfsg-2ubuntu7 zlib1g-dev_1:1.2.11.dfsg-2ubuntu7 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- gpgv: Signature made Sat Dec 12 12:17:40 2020 UTC gpgv: using RSA key D56571B88A8BBAF140BF63D6BD7EAA60778FA6F5 gpgv: issuer "doko@ubuntu.com" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./ataqv_1.2.1+ds-1build1.dsc dpkg-source: info: extracting ataqv in /<>/ataqv-1.2.1+ds dpkg-source: info: unpacking ataqv_1.2.1+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.2.1+ds-1build1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=noautodbgsym parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-22120063 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-22120063 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-22120063 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- dpkg-buildpackage.pl: info: source package ataqv dpkg-buildpackage.pl: info: source version 1.2.1+ds-1build1 dpkg-buildpackage.pl: info: source distribution hirsute dpkg-source --before-build . dpkg-buildpackage.pl: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/<>/ataqv-1.2.1+ds' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' debian/rules override_dh_auto_build make[1]: Entering directory '/<>/ataqv-1.2.1+ds' dh_auto_build -- all testing/run_ataqv_tests make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/<>/ataqv-1.2.1+ds' g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/ataqv.o -c /<>/ataqv-1.2.1+ds/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/run_ataqv_tests.o -c /<>/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_features.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_hts.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /<>/ataqv-1.2.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_io.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_io.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:172:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 172 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:177:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 177 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____242()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:248:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 248 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____251()’: /<>/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:258:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 258 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp In file included from /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:1: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /<>/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/test_utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/test_utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/Features.o -c /<>/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/HTS.o -c /<>/ataqv-1.2.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/IO.o -c /<>/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/Metrics.o -c /<>/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/Peaks.o -c /<>/ataqv-1.2.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/Utils.o -c /<>/ataqv-1.2.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -flto=auto -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread g++ -g -O2 -ffile-prefix-map=/<>/ataqv-1.2.1+ds=. -flto=auto -ffat-lto-objects -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/ataqv-1.2.1+ds/src/cpp -D AMD64 -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -flto=auto -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_auto_test make -j4 test make[1]: Entering directory '/<>/ataqv-1.2.1+ds' Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 4.29786 seconds. (5814.28 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 21.4723 seconds. (1736.01 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 26.9648 seconds. (1382.39 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 29.397 seconds. (1268.012 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 =============================================================================== All tests passed (241 assertions in 54 test cases) make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' create-stamp debian/debhelper-build-stamp dh_prep debian/rules override_dh_auto_install make[1]: Entering directory '/<>/ataqv-1.2.1+ds' dh_auto_install -- prefix=/usr make -j4 install DESTDIR=/<>/ataqv-1.2.1\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr make[2]: Entering directory '/<>/ataqv-1.2.1+ds' Installing to /usr install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -m 0755 build/ataqv /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -d -m 0755 /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.2.1/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /<>/ataqv-1.2.1+ds/debian/ataqv/usr/bin; done cp -a src/web/* /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web find /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /<>/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; make[2]: Leaving directory '/<>/ataqv-1.2.1+ds' make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_install dh_installdocs dh_installchangelogs dh_installexamples debian/rules override_dh_installman make[1]: Entering directory '/<>/ataqv-1.2.1+ds' help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.2.1+ds src/scripts/srvarv > debian/srvarv.1 dh_installman make[1]: Leaving directory '/<>/ataqv-1.2.1+ds' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a debugedit: debian/ataqv/usr/bin/ataqv: Unknown DWARF DW_FORM_0x1f20 b48222e31b7d6d3928f4b99b5aaef75a4bd05532 debugedit: debian/ataqv/usr/lib/ataqv/run_ataqv_tests: Unknown DWARF DW_FORM_0x1f20 5eed6b2f922273b65f390ac306a544dadc99f14b dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb INFO: pkgstriptranslations version 148 pkgstriptranslations: processing ataqv (in debian/ataqv); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/ataqv/DEBIAN/control, package ataqv, directory debian/ataqv pkgstripfiles: Running PNG optimization (using 4 cpus) for package ataqv ... pkgstripfiles: No PNG files. dpkg-deb: building package 'ataqv' in '../ataqv_1.2.1+ds-1build1_amd64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary -mLaunchpad Build Daemon >../ataqv_1.2.1+ds-1build1_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage.pl: info: binary-only upload (no source included) === USAGE-SUMMARY BEGIN === SUMMARY: host: lgw01-amd64-046; CPUs: 4/4; CPU avg: 56%; CPU max: 100%; base memory: 0.2 GB; peak memory: 1.6 GB; total memory: 7.8 GB SUMMARY: swap peak/total: 0.0/4.0 GB; disk start/end/total: 3.4/3.6/58.0 GB; disk delta: 0.1 GB === USAGE-SUMMARY END === -------------------------------------------------------------------------------- Build finished at 2021-09-29T04:20:56Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Post Build Chroot | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ ataqv_1.2.1+ds-1build1_amd64.changes: ------------------------------------- Format: 1.8 Date: Sat, 12 Dec 2020 13:03:13 +0100 Source: ataqv Binary: ataqv Built-For-Profiles: noudeb Architecture: amd64 Version: 1.2.1+ds-1build1 Distribution: impish Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Matthias Klose Description: ataqv - ATAC-seq QC and visualization Changes: ataqv (1.2.1+ds-1build1) hirsute; urgency=medium . * No-change rebuild for boost soname change. Checksums-Sha1: 64cc01f0368191cc2f1089925cc8900ec4a0f31a 9232 ataqv_1.2.1+ds-1build1_amd64.buildinfo e709edc819d2fdf1bdeb1e755ecb3b8a4c892706 3422700 ataqv_1.2.1+ds-1build1_amd64.deb Checksums-Sha256: 6fbeaef18a4b685a570e733118211e1edc9a11764769fd548f47daa78856f0f1 9232 ataqv_1.2.1+ds-1build1_amd64.buildinfo 06dac8096b593435fab724cfccae4b3bef97cb06e116c29d63902750f86cbae3 3422700 ataqv_1.2.1+ds-1build1_amd64.deb Files: 3807af62a3022bfce3ab620710dcd89d 9232 science optional ataqv_1.2.1+ds-1build1_amd64.buildinfo 3cb2cec06578654dded92e460b7ca10a 3422700 science optional ataqv_1.2.1+ds-1build1_amd64.deb +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: ataqv Binary: ataqv Architecture: amd64 Version: 1.2.1+ds-1build1 Checksums-Md5: 3cb2cec06578654dded92e460b7ca10a 3422700 ataqv_1.2.1+ds-1build1_amd64.deb Checksums-Sha1: e709edc819d2fdf1bdeb1e755ecb3b8a4c892706 3422700 ataqv_1.2.1+ds-1build1_amd64.deb Checksums-Sha256: 06dac8096b593435fab724cfccae4b3bef97cb06e116c29d63902750f86cbae3 3422700 ataqv_1.2.1+ds-1build1_amd64.deb Build-Origin: Ubuntu Build-Architecture: amd64 Build-Date: Wed, 29 Sep 2021 04:20:55 +0000 Build-Path: /<>/ataqv-1.2.1+ds Build-Tainted-By: merged-usr-via-aliased-dirs usr-local-has-programs Installed-Build-Depends: autoconf (= 2.69-14), automake (= 1:1.16.4-2), autopoint (= 0.21-4ubuntu3), autotools-dev (= 20180224.1+nmu1), base-files (= 11.1ubuntu3), base-passwd (= 3.5.51), bash (= 5.1-3ubuntu1), binutils (= 2.37-7ubuntu1), binutils-common (= 2.37-7ubuntu1), binutils-x86-64-linux-gnu (= 2.37-7ubuntu1), bsdextrautils (= 2.36.1-8ubuntu1), bsdutils (= 1:2.36.1-8ubuntu1), build-essential (= 12.9ubuntu1), bzip2 (= 1.0.8-4ubuntu3), coreutils (= 8.32-4ubuntu2), cpp (= 4:11.2.0-1ubuntu1), cpp-10 (= 10.3.0-11ubuntu1), cpp-11 (= 11.2.0-7ubuntu2), dash (= 0.5.11+git20210120+802ebd4-1), debconf (= 1.5.77), debhelper (= 13.3.4ubuntu2), debianutils (= 4.11.2), debugedit (= 1:5.0-0ubuntu2), dh-autoreconf (= 20), dh-strip-nondeterminism (= 1.12.0-1), diffutils (= 1:3.8-0ubuntu1), dpkg (= 1.20.9ubuntu13), dpkg-dev (= 1.20.9ubuntu13), dwz (= 0.14-1), file (= 1:5.39-3), findutils (= 4.8.0-1ubuntu2), fonts-font-awesome (= 5.0.10+really4.7.0~dfsg-4.1), g++ (= 4:11.2.0-1ubuntu1), g++-11 (= 11.2.0-7ubuntu2), gcc (= 4:11.2.0-1ubuntu1), gcc-10 (= 10.3.0-11ubuntu1), gcc-10-base (= 10.3.0-11ubuntu1), gcc-11 (= 11.2.0-7ubuntu2), gcc-11-base (= 11.2.0-7ubuntu2), gettext (= 0.21-4ubuntu3), gettext-base (= 0.21-4ubuntu3), grep (= 3.7-0ubuntu1), groff-base (= 1.22.4-7), gzip (= 1.10-4ubuntu1), help2man (= 1.48.4), hostname (= 3.23), icu-devtools (= 67.1-7ubuntu1), init-system-helpers (= 1.60), intltool-debian (= 0.35.0+20060710.5), libacl1 (= 2.2.53-10ubuntu1), libarchive-zip-perl (= 1.68-1), libasan6 (= 11.2.0-7ubuntu2), libatomic1 (= 11.2.0-7ubuntu2), libattr1 (= 1:2.4.48-6build1), libaudit-common (= 1:3.0-2ubuntu2), libaudit1 (= 1:3.0-2ubuntu2), libbinutils (= 2.37-7ubuntu1), libblkid1 (= 2.36.1-8ubuntu1), libboost-chrono-dev (= 1.74.0.3ubuntu5), libboost-chrono1.74-dev (= 1.74.0-8ubuntu6), libboost-chrono1.74.0 (= 1.74.0-8ubuntu6), libboost-filesystem-dev (= 1.74.0.3ubuntu5), libboost-filesystem1.74-dev (= 1.74.0-8ubuntu6), libboost-filesystem1.74.0 (= 1.74.0-8ubuntu6), libboost-iostreams-dev (= 1.74.0.3ubuntu5), libboost-iostreams1.74-dev (= 1.74.0-8ubuntu6), libboost-iostreams1.74.0 (= 1.74.0-8ubuntu6), libboost-regex1.74-dev (= 1.74.0-8ubuntu6), libboost-regex1.74.0 (= 1.74.0-8ubuntu6), libboost-system-dev (= 1.74.0.3ubuntu5), libboost-system1.74-dev (= 1.74.0-8ubuntu6), libboost-system1.74.0 (= 1.74.0-8ubuntu6), libboost1.74-dev (= 1.74.0-8ubuntu6), libbrotli1 (= 1.0.9-2build2), libbz2-1.0 (= 1.0.8-4ubuntu3), libc-ares2 (= 1.17.1-1ubuntu1), libc-bin (= 2.34-0ubuntu2), libc-dev-bin (= 2.34-0ubuntu2), libc6 (= 2.34-0ubuntu2), libc6-dev (= 2.34-0ubuntu2), libcap-ng0 (= 0.7.9-2.2build1), libcap2 (= 1:2.44-1build1), libcc1-0 (= 11.2.0-7ubuntu2), libcom-err2 (= 1.46.3-1ubuntu3), libcrypt-dev (= 1:4.4.18-4ubuntu1), libcrypt1 (= 1:4.4.18-4ubuntu1), libctf-nobfd0 (= 2.37-7ubuntu1), libctf0 (= 2.37-7ubuntu1), libcurl3-gnutls (= 7.74.0-1.3ubuntu2), libcurl4-gnutls-dev (= 7.74.0-1.3ubuntu2), libdb5.3 (= 5.3.28+dfsg1-0.8ubuntu1), libdebconfclient0 (= 0.256ubuntu3), libdebhelper-perl (= 13.3.4ubuntu2), libdeflate-dev (= 1.7-2ubuntu2), libdeflate0 (= 1.7-2ubuntu2), libdpkg-perl (= 1.20.9ubuntu13), libdw1 (= 0.185-1), libelf1 (= 0.185-1), libexpat1 (= 2.4.1-2), libffi8 (= 3.4.2-1ubuntu5), libfile-stripnondeterminism-perl (= 1.12.0-1), libgcc-10-dev (= 10.3.0-11ubuntu1), libgcc-11-dev (= 11.2.0-7ubuntu2), libgcc-s1 (= 11.2.0-7ubuntu2), libgcrypt20 (= 1.8.7-5ubuntu2), libgdbm-compat4 (= 1.19-2), libgdbm6 (= 1.19-2), libgmp10 (= 2:6.2.1+dfsg-1ubuntu2), libgnutls30 (= 3.7.1-5ubuntu1), libgomp1 (= 11.2.0-7ubuntu2), libgpg-error0 (= 1.38-2build1), libgssapi-krb5-2 (= 1.18.3-6), libhogweed6 (= 3.7.3-1), libhts-dev (= 1.13+ds-2), libhts3 (= 1.13+ds-2), libhtscodecs2 (= 1.1.1-2), libicu-dev (= 67.1-7ubuntu1), libicu67 (= 67.1-7ubuntu1), libidn2-0 (= 2.3.1-1), libisl23 (= 0.24-1), libitm1 (= 11.2.0-7ubuntu2), libjs-d3-format (= 1:1.4.1-3), libjs-jquery (= 3.5.1+dfsg+~3.5.5-7), libjs-jquery-datatables (= 1.10.21+dfsg-2), libjs-jquery-datatables-extensions (= 0.0+git20150910.28fd64e+dfsg-5), libk5crypto3 (= 1.18.3-6), libkeyutils1 (= 1.6.1-2ubuntu1), libkrb5-3 (= 1.18.3-6), libkrb5support0 (= 1.18.3-6), libldap-2.5-0 (= 2.5.6+dfsg-1~exp1ubuntu1), liblocale-gettext-perl (= 1.07-4build1), liblsan0 (= 11.2.0-7ubuntu2), liblz4-1 (= 1.9.3-2), liblzma-dev (= 5.2.5-2), liblzma5 (= 5.2.5-2), libmagic-mgc (= 1:5.39-3), libmagic1 (= 1:5.39-3), libmount1 (= 2.36.1-8ubuntu1), libmpc3 (= 1.2.0-1build1), libmpdec3 (= 2.5.1-2), libmpfr6 (= 4.1.0-3build1), libncurses-dev (= 6.2+20201114-2build1), libncurses5-dev (= 6.2+20201114-2build1), libncurses6 (= 6.2+20201114-2build1), libncursesw6 (= 6.2+20201114-2build1), libnettle8 (= 3.7.3-1), libnghttp2-14 (= 1.43.0-1), libnode72 (= 12.22.5~dfsg-5ubuntu1), libnsl-dev (= 1.3.0-2), libnsl2 (= 1.3.0-2), libp11-kit0 (= 0.23.22-1build1), libpam-modules (= 1.3.1-5ubuntu11), libpam-modules-bin (= 1.3.1-5ubuntu11), libpam-runtime (= 1.3.1-5ubuntu11), libpam0g (= 1.3.1-5ubuntu11), libpcre2-8-0 (= 10.37-0ubuntu2), libpcre3 (= 2:8.39-13build3), libperl5.32 (= 5.32.1-3ubuntu3), libpipeline1 (= 1.5.3-1), libpsl5 (= 0.21.0-1.2), libpython3-stdlib (= 3.9.4-1), libpython3.9-minimal (= 3.9.7-2build1), libpython3.9-stdlib (= 3.9.7-2build1), libquadmath0 (= 11.2.0-7ubuntu2), libreadline8 (= 8.1-2), librtmp1 (= 2.4+20151223.gitfa8646d.1-2build2), libsasl2-2 (= 2.1.27+dfsg-2.1build1), libsasl2-modules-db (= 2.1.27+dfsg-2.1build1), libseccomp2 (= 2.5.1-1ubuntu1), libselinux1 (= 3.1-3build1), libsigsegv2 (= 2.13-1ubuntu1), libsmartcols1 (= 2.36.1-8ubuntu1), libsqlite3-0 (= 3.35.5-1), libssh-4 (= 0.9.6-1), libssl1.1 (= 1.1.1l-1ubuntu1), libstdc++-10-dev (= 10.3.0-11ubuntu1), libstdc++-11-dev (= 11.2.0-7ubuntu2), libstdc++6 (= 11.2.0-7ubuntu2), libsub-override-perl (= 0.09-2), libsystemd0 (= 248.3-1ubuntu7), libtasn1-6 (= 4.16.0-2), libtinfo6 (= 6.2+20201114-2build1), libtirpc-common (= 1.3.2-2), libtirpc-dev (= 1.3.2-2), libtirpc3 (= 1.3.2-2), libtool (= 2.4.6-15), libtsan0 (= 11.2.0-7ubuntu2), libubsan1 (= 11.2.0-7ubuntu2), libuchardet0 (= 0.0.7-1), libudev1 (= 248.3-1ubuntu7), libunistring2 (= 0.9.10-6), libuuid1 (= 2.36.1-8ubuntu1), libuv1 (= 1.40.0-2ubuntu1), libxml2 (= 2.9.12+dfsg-4), libzstd1 (= 1.4.8+dfsg-2.1), linux-libc-dev (= 5.13.0-16.16), login (= 1:4.8.1-1ubuntu9), lsb-base (= 11.1.0ubuntu2), lto-disabled-list (= 16), m4 (= 1.4.18-5ubuntu1), make (= 4.3-4ubuntu1), man-db (= 2.9.4-2), mawk (= 1.3.4.20200120-2), media-types (= 4.0.0), ncurses-base (= 6.2+20201114-2build1), ncurses-bin (= 6.2+20201114-2build1), node-commander (= 6.2.1-2), node-d3 (= 5.16.0-4), node-d3-array (= 1.2.4-3), node-d3-axis (= 1.0.12-3), node-d3-brush (= 1.1.5-2), node-d3-chord (= 1.0.6-3), node-d3-collection (= 1.0.7-3), node-d3-color (= 1.2.8-2), node-d3-contour (= 1.3.2-4), node-d3-dispatch (= 1.0.6-2), node-d3-drag (= 1.2.5-2), node-d3-dsv (= 1.1.1-5), node-d3-ease (= 1.0.5-3), node-d3-fetch (= 1.2.0-1), node-d3-force (= 1.2.1-2), node-d3-format (= 1:1.4.1-3), node-d3-geo (= 1.11.9-4), node-d3-hierarchy (= 1.1.8-3), node-d3-interpolate (= 1.4.0-2), node-d3-path (= 1.0.9-2), node-d3-polygon (= 1.0.5-3), node-d3-quadtree (= 1.0.7-2), node-d3-queue (= 3.0.7-11), node-d3-random (= 1.1.2-3), node-d3-scale (= 2.2.2-3), node-d3-scale-chromatic (= 1.5.0-2), node-d3-selection (= 1.4.0-6), node-d3-shape (= 1.3.7-2), node-d3-time (= 1.0.11-4), node-d3-time-format (= 2.1.3-3), node-d3-timer (= 1.0.10-1), node-d3-transition (= 1.3.2-3), node-d3-voronoi (= 1.1.4-3), node-d3-zoom (= 1.8.3-2), node-iconv-lite (= 0.5.1-3), node-normalize.css (= 8.0.1-3), node-rw (= 1.3.3-2), nodejs (= 12.22.5~dfsg-5ubuntu1), patch (= 2.7.6-7), perl (= 5.32.1-3ubuntu3), perl-base (= 5.32.1-3ubuntu3), perl-modules-5.32 (= 5.32.1-3ubuntu3), po-debconf (= 1.0.21+nmu1), python3 (= 3.9.4-1), python3-minimal (= 3.9.4-1), python3-psutil (= 5.8.0-1), python3.9 (= 3.9.7-2build1), python3.9-minimal (= 3.9.7-2build1), readline-common (= 8.1-2), rpcsvc-proto (= 1.4.2-0ubuntu4), sed (= 4.7-1ubuntu1), sensible-utils (= 0.0.14), sysvinit-utils (= 2.96-7ubuntu1), tar (= 1.34+dfsg-1build1), tzdata (= 2021a-1ubuntu1), util-linux (= 2.36.1-8ubuntu1), xz-utils (= 5.2.5-2), zlib1g (= 1:1.2.11.dfsg-2ubuntu7), zlib1g-dev (= 1:1.2.11.dfsg-2ubuntu7) Environment: DEB_BUILD_OPTIONS="noautodbgsym parallel=4" DEB_BUILD_PROFILES="noudeb" LANG="C.UTF-8" LC_ALL="C.UTF-8" SOURCE_DATE_EPOCH="1607774593" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ ataqv_1.2.1+ds-1build1_amd64.deb -------------------------------- new Debian package, version 2.0. size 3422700 bytes: control archive=1739 bytes. 1052 bytes, 17 lines control 2422 bytes, 32 lines md5sums Package: ataqv Version: 1.2.1+ds-1build1 Architecture: amd64 Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 6236 Depends: libboost-chrono1.74.0 (>= 1.74.0), libboost-filesystem1.74.0 (>= 1.74.0), libboost-iostreams1.74.0 (>= 1.74.0), libc6 (>= 2.34), libgcc-s1 (>= 3.3.1), libhts3 (>= 1.10), libncurses6 (>= 6), libstdc++6 (>= 11), libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, python3, node-d3 Suggests: picard-tools, samtools, macs, wget Section: science Priority: optional Homepage: https://github.com/ParkerLab/ataqv/ Description: ATAC-seq QC and visualization A toolkit for measuring and comparing ATAC-seq results, made in the Parker lab at the University of Michigan. They wrote it to help understand how well their ATAC-seq assays had worked, and to make it easier to spot differences that might be caused by library prep or sequencing. drwxr-xr-x root/root 0 2020-12-12 12:03 ./ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/bin/ -rwxr-xr-x root/root 429176 2020-12-12 12:03 ./usr/bin/ataqv -rwxr-xr-x root/root 3020 2020-12-12 12:03 ./usr/bin/make_ataqv_pipeline -rwxr-xr-x root/root 36049 2020-12-12 12:03 ./usr/bin/mkarv -rwxr-xr-x root/root 1634 2020-12-12 12:03 ./usr/bin/run_ataqv_example -rwxr-xr-x root/root 1142 2020-12-12 12:03 ./usr/bin/srvarv drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/lib/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/lib/ataqv/ -rwxr-xr-x root/root 981568 2020-12-12 12:03 ./usr/lib/ataqv/run_ataqv_tests drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/ -rw-r--r-- root/root 18865 2020-07-08 15:43 ./usr/share/ataqv/web/css/ataqv.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/datatables.buttons.min.css -> ../../../javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css -rw-r--r-- root/root 3362 2020-07-08 15:43 ./usr/share/ataqv/web/css/datatables.fontawesome.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/datatables.min.css -> ../../../javascript/jquery-datatables/css/jquery.dataTables.min.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/font-awesome.min.css -> ../../../fonts-font-awesome/css/font-awesome.min.css lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/css/normalize.css -> ../../../javascript/normalize.css/normalize.css drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/ lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/FontAwesome.otf -> ../../../fonts-font-awesome/fonts/FontAwesome.otf lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.eot -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.eot lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.svg -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.svg lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.ttf -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.ttf lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff2 -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff2 -rw-r--r-- root/root 34052 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-regular.woff -rw-r--r-- root/root 28724 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-regularit.woff -rw-r--r-- root/root 33848 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-semibold.woff -rw-r--r-- root/root 28624 2020-07-08 15:43 ./usr/share/ataqv/web/fonts/sourcesanspro-semiboldit.woff -rw-r--r-- root/root 51122 2020-12-12 12:03 ./usr/share/ataqv/web/index.html drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/ -rw-r--r-- root/root 69250 2020-07-08 15:43 ./usr/share/ataqv/web/js/ataqv.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.colVis.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.html5.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/buttons.print.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/d3.min.js -> ../../../nodejs/d3/dist/d3.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/dataTables.buttons.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/dataTables.responsive.min.js -> ../../../javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jquery.dataTables.min.js -> ../../../javascript/jquery-datatables/jquery.dataTables.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jquery.min.js -> ../../../javascript/jquery/jquery.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/jszip.min.js -> ../../../javascript/jquery-datatables-extensions/JSZip/jszip.min.js lrwxrwxrwx root/root 0 2020-12-12 12:03 ./usr/share/ataqv/web/js/pdfmake.min.js -> ../../../javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/ -rw-r--r-- root/root 5178 2020-07-08 15:43 ./usr/share/doc/ataqv/README.rst.gz -rw-r--r-- root/root 565 2020-12-12 12:03 ./usr/share/doc/ataqv/changelog.Debian.gz -rw-r--r-- root/root 8547 2020-10-01 11:29 ./usr/share/doc/ataqv/copyright drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/ -rw-r--r-- root/root 37149 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam -rw-r--r-- root/root 773256 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam.bai -rw-r--r-- root/root 418285 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/SRR891275.peaks.gz -rw-r--r-- root/root 37198 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/SRR891278.bam -rw-r--r-- root/root 952573 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/SRR891278.peaks.gz -rw-r--r-- root/root 4708 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/exclude.dac.bed.gz -rw-r--r-- root/root 17130 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/exclude.duke.bed.gz -rw-r--r-- root/root 288924 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/hg19.tss.refseq.bed.gz -rwxr-xr-x root/root 2617 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/mktd.sh -rw-r--r-- root/root 72177 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/test.bam -rw-r--r-- root/root 1017208 2020-07-08 15:43 ./usr/share/doc/ataqv/examples/testdata/test.bam.bai -rw-r--r-- root/root 968461 2020-12-12 12:03 ./usr/share/doc/ataqv/examples/testdata/test.peaks.gz drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/man/ drwxr-xr-x root/root 0 2020-12-12 12:03 ./usr/share/man/man1/ -rw-r--r-- root/root 2008 2020-12-12 12:03 ./usr/share/man/man1/ataqv.1.gz -rw-r--r-- root/root 1630 2020-12-12 12:03 ./usr/share/man/man1/mkarv.1.gz -rw-r--r-- root/root 380 2020-12-12 12:03 ./usr/share/man/man1/srvarv.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: amd64 Build Type: binary Build-Space: n/a Build-Time: 283 Distribution: impish Host Architecture: amd64 Install-Time: 42 Job: ataqv_1.2.1+ds-1build1.dsc Machine Architecture: amd64 Package: ataqv Package-Time: 329 Source-Version: 1.2.1+ds-1build1 Space: n/a Status: successful Version: 1.2.1+ds-1build1 -------------------------------------------------------------------------------- Finished at 2021-09-29T04:20:56Z Build needed 00:05:29, no disk space Adding user buildd to group lxd RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=impish --arch=amd64 PACKAGEBUILD-22120063 Scanning for processes to kill in build PACKAGEBUILD-22120063