https://launchpad.net/ubuntu/+source/ataqv/1.3.0+ds-2/+build/24606054 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux bos02-s390x-006 5.4.0-139-generic #156-Ubuntu SMP Fri Jan 20 17:27:47 UTC 2023 s390x Buildd toolchain package versions: launchpad-buildd_230~623~ubuntu20.04.1 python3-lpbuildd_230~623~ubuntu20.04.1 sbuild_0.79.0-1ubuntu1 git-build-recipe_0.3.6 git_1:2.25.1-1ubuntu3.10 dpkg-dev_1.19.7ubuntu3.2 python3-debian_0.1.36ubuntu1. Syncing the system clock with the buildd NTP service... 20 Mar 11:15:52 ntpdate[1880]: adjust time server 10.211.37.1 offset -0.000000 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=lunar --arch=s390x PACKAGEBUILD-24606054 --image-type chroot /home/buildd/filecache-default/22b7ec405c1fe881d1e0795ebcfd3bff662be15c Creating target for build PACKAGEBUILD-24606054 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=lunar --arch=s390x PACKAGEBUILD-24606054 Starting target for build PACKAGEBUILD-24606054 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=lunar --arch=s390x PACKAGEBUILD-24606054 'deb http://ftpmaster.internal/ubuntu lunar main universe' 'deb http://ftpmaster.internal/ubuntu lunar-security main universe' 'deb http://ftpmaster.internal/ubuntu lunar-updates main universe' 'deb http://ftpmaster.internal/ubuntu lunar-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-24606054 RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=lunar --arch=s390x PACKAGEBUILD-24606054 Updating target for build PACKAGEBUILD-24606054 Get:1 http://ftpmaster.internal/ubuntu lunar InRelease [267 kB] Get:2 http://ftpmaster.internal/ubuntu lunar-security InRelease [90.7 kB] Get:3 http://ftpmaster.internal/ubuntu lunar-updates InRelease [90.7 kB] Get:4 http://ftpmaster.internal/ubuntu lunar-proposed InRelease [118 kB] Get:5 http://ftpmaster.internal/ubuntu lunar/main s390x Packages [1318 kB] Get:6 http://ftpmaster.internal/ubuntu lunar/main Translation-en [512 kB] Get:7 http://ftpmaster.internal/ubuntu lunar/universe s390x Packages [14.3 MB] Get:8 http://ftpmaster.internal/ubuntu lunar/universe Translation-en [5932 kB] Get:9 http://ftpmaster.internal/ubuntu lunar-proposed/main s390x Packages [39.9 kB] Get:10 http://ftpmaster.internal/ubuntu lunar-proposed/main Translation-en [24.4 kB] Get:11 http://ftpmaster.internal/ubuntu lunar-proposed/universe s390x Packages [94.3 kB] Get:12 http://ftpmaster.internal/ubuntu lunar-proposed/universe Translation-en [57.0 kB] Fetched 22.8 MB in 4s (5902 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following NEW packages will be installed: gcc-13-base libproc2-0 The following packages will be upgraded: adduser advancecomp apt bash binutils binutils-common binutils-s390x-linux-gnu ca-certificates coreutils cpp cpp-12 dash debconf diffutils dpkg dpkg-dev e2fsprogs fakeroot g++ g++-12 gcc gcc-12 gcc-12-base gpg gpg-agent gpgconf gpgv grep hostname libacl1 libapparmor1 libapt-pkg6.0 libasan8 libatomic1 libattr1 libaudit-common libaudit1 libbinutils libc-bin libc-dev-bin libc6 libc6-dev libcap-ng0 libcap2 libcc1-0 libcom-err2 libcrypt-dev libcrypt1 libcryptsetup12 libctf-nobfd0 libctf0 libdb5.3 libdebconfclient0 libdpkg-perl libext2fs2 libfakeroot libgcc-12-dev libgcc-s1 libgcrypt20 libgnutls30 libgomp1 libitm1 libkmod2 liblzma5 libmpfr6 libncurses6 libncursesw6 libp11-kit0 libpcre2-8-0 libperl5.36 libreadline8 libseccomp2 libselinux1 libsemanage-common libsemanage2 libsqlite3-0 libss2 libssl3 libstdc++-12-dev libstdc++6 libsystemd-shared libsystemd0 libtinfo6 libubsan1 libudev1 libzstd1 linux-libc-dev logsave lsb-base lto-disabled-list ncurses-base ncurses-bin openssl perl perl-base perl-modules-5.36 pkgbinarymangler procps readline-common sed sensible-utils systemd systemd-sysv sysvinit-utils tzdata xz-utils zlib1g 107 upgraded, 2 newly installed, 0 to remove and 0 not upgraded. Need to get 85.9 MB of archives. After this operation, 6690 kB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu lunar/main s390x bash s390x 5.2.15-2ubuntu1 [786 kB] Get:2 http://ftpmaster.internal/ubuntu lunar/main s390x coreutils s390x 9.1-1ubuntu2 [1390 kB] Get:3 http://ftpmaster.internal/ubuntu lunar/main s390x libcrypt-dev s390x 1:4.4.33-2 [114 kB] Get:4 http://ftpmaster.internal/ubuntu lunar-proposed/main s390x libc6-dev s390x 2.37-0ubuntu2 [1511 kB] Get:5 http://ftpmaster.internal/ubuntu lunar-proposed/main s390x libc-dev-bin s390x 2.37-0ubuntu2 [19.6 kB] Get:6 http://ftpmaster.internal/ubuntu lunar/main s390x libcrypt1 s390x 1:4.4.33-2 [82.2 kB] Get:7 http://ftpmaster.internal/ubuntu lunar/main s390x linux-libc-dev s390x 6.1.0-16.16 [1607 kB] Get:8 http://ftpmaster.internal/ubuntu lunar-proposed/main s390x libc6 s390x 2.37-0ubuntu2 [2684 kB] Get:9 http://ftpmaster.internal/ubuntu lunar-proposed/main s390x libc-bin s390x 2.37-0ubuntu2 [599 kB] Get:10 http://ftpmaster.internal/ubuntu lunar/main s390x gcc-13-base s390x 13-20230305-1ubuntu1 [40.6 kB] Get:11 http://ftpmaster.internal/ubuntu lunar/main s390x libgcc-s1 s390x 13-20230305-1ubuntu1 [35.6 kB] Get:12 http://ftpmaster.internal/ubuntu lunar/main s390x liblzma5 s390x 5.4.1-0.2 [124 kB] Get:13 http://ftpmaster.internal/ubuntu lunar/main s390x libgcrypt20 s390x 1.10.1-3ubuntu1 [466 kB] Get:14 http://ftpmaster.internal/ubuntu lunar/main s390x libstdc++6 s390x 13-20230305-1ubuntu1 [875 kB] Get:15 http://ftpmaster.internal/ubuntu lunar/main s390x libacl1 s390x 2.3.1-3 [16.5 kB] Get:16 http://ftpmaster.internal/ubuntu lunar/main s390x libapparmor1 s390x 3.0.8-1ubuntu2 [46.2 kB] Get:17 http://ftpmaster.internal/ubuntu lunar/main s390x libaudit-common all 1:3.0.9-1 [5142 B] Get:18 http://ftpmaster.internal/ubuntu lunar/main s390x libcap-ng0 s390x 0.8.3-1build2 [15.1 kB] Get:19 http://ftpmaster.internal/ubuntu lunar/main s390x libaudit1 s390x 1:3.0.9-1 [45.9 kB] Get:20 http://ftpmaster.internal/ubuntu lunar/main s390x libcap2 s390x 1:2.66-3ubuntu2 [28.4 kB] Get:21 http://ftpmaster.internal/ubuntu lunar/main s390x libperl5.36 s390x 5.36.0-7 [4716 kB] Get:22 http://ftpmaster.internal/ubuntu lunar/main s390x perl s390x 5.36.0-7 [235 kB] Get:23 http://ftpmaster.internal/ubuntu lunar/main s390x perl-base s390x 5.36.0-7 [1713 kB] Get:24 http://ftpmaster.internal/ubuntu lunar/main s390x perl-modules-5.36 all 5.36.0-7 [2984 kB] Get:25 http://ftpmaster.internal/ubuntu lunar/main s390x libdb5.3 s390x 5.3.28+dfsg2-1 [707 kB] Get:26 http://ftpmaster.internal/ubuntu lunar/main s390x zlib1g s390x 1:1.2.13.dfsg-1ubuntu4 [65.6 kB] Get:27 http://ftpmaster.internal/ubuntu lunar/main s390x debconf all 1.5.82 [125 kB] Get:28 http://ftpmaster.internal/ubuntu lunar/main s390x libssl3 s390x 3.0.8-1ubuntu1 [1576 kB] Get:29 http://ftpmaster.internal/ubuntu lunar/main s390x libzstd1 s390x 1.5.4+dfsg2-4 [269 kB] Get:30 http://ftpmaster.internal/ubuntu lunar/main s390x libkmod2 s390x 30+20221128-1ubuntu1 [48.1 kB] Get:31 http://ftpmaster.internal/ubuntu lunar/main s390x libseccomp2 s390x 2.5.4-1ubuntu3 [49.1 kB] Get:32 http://ftpmaster.internal/ubuntu lunar/main s390x libpcre2-8-0 s390x 10.42-1 [210 kB] Get:33 http://ftpmaster.internal/ubuntu lunar/main s390x libselinux1 s390x 3.4-1build4 [77.2 kB] Get:34 http://ftpmaster.internal/ubuntu lunar/main s390x systemd-sysv s390x 252.5-2ubuntu2 [11.5 kB] Get:35 http://ftpmaster.internal/ubuntu lunar/main s390x systemd s390x 252.5-2ubuntu2 [2861 kB] Get:36 http://ftpmaster.internal/ubuntu lunar/main s390x libsystemd-shared s390x 252.5-2ubuntu2 [1729 kB] Get:37 http://ftpmaster.internal/ubuntu lunar/main s390x libcryptsetup12 s390x 2:2.6.1-1ubuntu1 [215 kB] Get:38 http://ftpmaster.internal/ubuntu lunar/main s390x libp11-kit0 s390x 0.24.1-2ubuntu1 [249 kB] Get:39 http://ftpmaster.internal/ubuntu lunar/main s390x libsystemd0 s390x 252.5-2ubuntu2 [378 kB] Get:40 http://ftpmaster.internal/ubuntu lunar/main s390x libudev1 s390x 252.5-2ubuntu2 [148 kB] Get:41 http://ftpmaster.internal/ubuntu lunar/main s390x libapt-pkg6.0 s390x 2.6.0 [888 kB] Get:42 http://ftpmaster.internal/ubuntu lunar/main s390x dpkg s390x 1.21.21ubuntu1 [1380 kB] Get:43 http://ftpmaster.internal/ubuntu lunar/main s390x dash s390x 0.5.12-2ubuntu1 [88.8 kB] Get:44 http://ftpmaster.internal/ubuntu lunar/main s390x diffutils s390x 1:3.8-4 [177 kB] Get:45 http://ftpmaster.internal/ubuntu lunar/main s390x grep s390x 3.8-5 [160 kB] Get:46 http://ftpmaster.internal/ubuntu lunar/main s390x hostname s390x 3.23+nmu1ubuntu1 [10.8 kB] Get:47 http://ftpmaster.internal/ubuntu lunar/main s390x ncurses-bin s390x 6.4-2 [186 kB] Get:48 http://ftpmaster.internal/ubuntu lunar/main s390x sed s390x 4.9-1 [193 kB] Get:49 http://ftpmaster.internal/ubuntu lunar/main s390x ncurses-base all 6.4-2 [21.3 kB] Get:50 http://ftpmaster.internal/ubuntu lunar/main s390x sysvinit-utils s390x 3.06-2ubuntu1 [32.7 kB] Get:51 http://ftpmaster.internal/ubuntu lunar/main s390x lsb-base all 11.6 [4606 B] Get:52 http://ftpmaster.internal/ubuntu lunar/main s390x adduser all 3.129ubuntu1 [59.0 kB] Get:53 http://ftpmaster.internal/ubuntu lunar/main s390x gpgv s390x 2.2.40-1ubuntu2 [134 kB] Get:54 http://ftpmaster.internal/ubuntu lunar/main s390x libgnutls30 s390x 3.7.8-5ubuntu1 [892 kB] Get:55 http://ftpmaster.internal/ubuntu lunar/main s390x apt s390x 2.6.0 [1360 kB] Get:56 http://ftpmaster.internal/ubuntu lunar/main s390x logsave s390x 1.47.0-1ubuntu1 [14.1 kB] Get:57 http://ftpmaster.internal/ubuntu lunar/main s390x libext2fs2 s390x 1.47.0-1ubuntu1 [212 kB] Get:58 http://ftpmaster.internal/ubuntu lunar/main s390x e2fsprogs s390x 1.47.0-1ubuntu1 [589 kB] Get:59 http://ftpmaster.internal/ubuntu lunar/main s390x libattr1 s390x 1:2.5.1-4 [12.4 kB] Get:60 http://ftpmaster.internal/ubuntu lunar/main s390x libdebconfclient0 s390x 0.267ubuntu1 [7838 B] Get:61 http://ftpmaster.internal/ubuntu lunar/main s390x libsemanage-common all 3.4-1build4 [9852 B] Get:62 http://ftpmaster.internal/ubuntu lunar/main s390x libsemanage2 s390x 3.4-1build4 [88.5 kB] Get:63 http://ftpmaster.internal/ubuntu lunar/main s390x libncurses6 s390x 6.4-2 [111 kB] Get:64 http://ftpmaster.internal/ubuntu lunar/main s390x libncursesw6 s390x 6.4-2 [143 kB] Get:65 http://ftpmaster.internal/ubuntu lunar/main s390x libtinfo6 s390x 6.4-2 [101 kB] Get:66 http://ftpmaster.internal/ubuntu lunar/main s390x libcom-err2 s390x 1.47.0-1ubuntu1 [14.4 kB] Get:67 http://ftpmaster.internal/ubuntu lunar/main s390x libproc2-0 s390x 2:4.0.3-1ubuntu1 [52.0 kB] Get:68 http://ftpmaster.internal/ubuntu lunar/main s390x libss2 s390x 1.47.0-1ubuntu1 [16.6 kB] Get:69 http://ftpmaster.internal/ubuntu lunar/main s390x procps s390x 2:4.0.3-1ubuntu1 [605 kB] Get:70 http://ftpmaster.internal/ubuntu lunar/main s390x sensible-utils all 0.0.17+nmu1 [19.3 kB] Get:71 http://ftpmaster.internal/ubuntu lunar/main s390x openssl s390x 3.0.8-1ubuntu1 [1166 kB] Get:72 http://ftpmaster.internal/ubuntu lunar/main s390x ca-certificates all 20230311 [155 kB] Get:73 http://ftpmaster.internal/ubuntu lunar/main s390x readline-common all 8.2-1.3 [55.7 kB] Get:74 http://ftpmaster.internal/ubuntu lunar/main s390x libreadline8 s390x 8.2-1.3 [151 kB] Get:75 http://ftpmaster.internal/ubuntu lunar/main s390x libsqlite3-0 s390x 3.40.1-1 [642 kB] Get:76 http://ftpmaster.internal/ubuntu lunar/main s390x tzdata all 2022g-7ubuntu2 [270 kB] Get:77 http://ftpmaster.internal/ubuntu lunar/main s390x xz-utils s390x 5.4.1-0.2 [270 kB] Get:78 http://ftpmaster.internal/ubuntu lunar/main s390x advancecomp s390x 2.5-1 [174 kB] Get:79 http://ftpmaster.internal/ubuntu lunar/main s390x libctf0 s390x 2.40-2ubuntu3 [94.2 kB] Get:80 http://ftpmaster.internal/ubuntu lunar/main s390x libctf-nobfd0 s390x 2.40-2ubuntu3 [95.3 kB] Get:81 http://ftpmaster.internal/ubuntu lunar/main s390x binutils-s390x-linux-gnu s390x 2.40-2ubuntu3 [2061 kB] Get:82 http://ftpmaster.internal/ubuntu lunar/main s390x libbinutils s390x 2.40-2ubuntu3 [463 kB] Get:83 http://ftpmaster.internal/ubuntu lunar/main s390x binutils s390x 2.40-2ubuntu3 [3038 B] Get:84 http://ftpmaster.internal/ubuntu lunar/main s390x binutils-common s390x 2.40-2ubuntu3 [226 kB] Get:85 http://ftpmaster.internal/ubuntu lunar/main s390x libmpfr6 s390x 4.2.0-1 [278 kB] Get:86 http://ftpmaster.internal/ubuntu lunar/main s390x g++-12 s390x 12.2.0-17ubuntu1 [9435 kB] Get:87 http://ftpmaster.internal/ubuntu lunar/main s390x gcc-12 s390x 12.2.0-17ubuntu1 [16.2 MB] Get:88 http://ftpmaster.internal/ubuntu lunar/main s390x cpp-12 s390x 12.2.0-17ubuntu1 [8164 kB] Get:89 http://ftpmaster.internal/ubuntu lunar/main s390x libubsan1 s390x 13-20230305-1ubuntu1 [1108 kB] Get:90 http://ftpmaster.internal/ubuntu lunar/main s390x libgomp1 s390x 13-20230305-1ubuntu1 [146 kB] Get:91 http://ftpmaster.internal/ubuntu lunar/main s390x libitm1 s390x 13-20230305-1ubuntu1 [31.3 kB] Get:92 http://ftpmaster.internal/ubuntu lunar/main s390x libatomic1 s390x 13-20230305-1ubuntu1 [9444 B] Get:93 http://ftpmaster.internal/ubuntu lunar/main s390x libasan8 s390x 13-20230305-1ubuntu1 [2839 kB] Get:94 http://ftpmaster.internal/ubuntu lunar/main s390x libstdc++-12-dev s390x 12.2.0-17ubuntu1 [2191 kB] Get:95 http://ftpmaster.internal/ubuntu lunar/main s390x libgcc-12-dev s390x 12.2.0-17ubuntu1 [852 kB] Get:96 http://ftpmaster.internal/ubuntu lunar/main s390x libcc1-0 s390x 13-20230305-1ubuntu1 [50.3 kB] Get:97 http://ftpmaster.internal/ubuntu lunar/main s390x gcc-12-base s390x 12.2.0-17ubuntu1 [41.4 kB] Get:98 http://ftpmaster.internal/ubuntu lunar/main s390x g++ s390x 4:12.2.0-3ubuntu1 [1116 B] Get:99 http://ftpmaster.internal/ubuntu lunar/main s390x gcc s390x 4:12.2.0-3ubuntu1 [5168 B] Get:100 http://ftpmaster.internal/ubuntu lunar/main s390x cpp s390x 4:12.2.0-3ubuntu1 [27.8 kB] Get:101 http://ftpmaster.internal/ubuntu lunar/main s390x dpkg-dev all 1.21.21ubuntu1 [1117 kB] Get:102 http://ftpmaster.internal/ubuntu lunar/main s390x libdpkg-perl all 1.21.21ubuntu1 [247 kB] Get:103 http://ftpmaster.internal/ubuntu lunar/main s390x lto-disabled-list all 38 [12.3 kB] Get:104 http://ftpmaster.internal/ubuntu lunar/main s390x libfakeroot s390x 1.31-1.1 [30.9 kB] Get:105 http://ftpmaster.internal/ubuntu lunar/main s390x fakeroot s390x 1.31-1.1 [59.6 kB] Get:106 http://ftpmaster.internal/ubuntu lunar/main s390x gpg s390x 2.2.40-1ubuntu2 [508 kB] Get:107 http://ftpmaster.internal/ubuntu lunar/main s390x gpgconf s390x 2.2.40-1ubuntu2 [94.8 kB] Get:108 http://ftpmaster.internal/ubuntu lunar/main s390x gpg-agent s390x 2.2.40-1ubuntu2 [213 kB] Get:109 http://ftpmaster.internal/ubuntu lunar/main s390x pkgbinarymangler all 152 [16.2 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 85.9 MB in 4s (21.1 MB/s) (Reading database ... 12875 files and directories currently installed.) Preparing to unpack .../bash_5.2.15-2ubuntu1_s390x.deb ... Unpacking bash (5.2.15-2ubuntu1) over (5.2-1ubuntu2) ... Setting up bash (5.2.15-2ubuntu1) ... update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode (Reading database ... 12875 files and directories currently installed.) Preparing to unpack .../coreutils_9.1-1ubuntu2_s390x.deb ... Unpacking coreutils (9.1-1ubuntu2) over (8.32-4.1ubuntu1) ... Setting up coreutils (9.1-1ubuntu2) ... (Reading database ... 12875 files and directories currently installed.) Preparing to unpack .../libcrypt-dev_1%3a4.4.33-2_s390x.deb ... Unpacking libcrypt-dev:s390x (1:4.4.33-2) over (1:4.4.33-1) ... Preparing to unpack .../libc6-dev_2.37-0ubuntu2_s390x.deb ... Unpacking libc6-dev:s390x (2.37-0ubuntu2) over (2.36-0ubuntu4) ... Preparing to unpack .../libc-dev-bin_2.37-0ubuntu2_s390x.deb ... Unpacking libc-dev-bin (2.37-0ubuntu2) over (2.36-0ubuntu4) ... Preparing to unpack .../libcrypt1_1%3a4.4.33-2_s390x.deb ... Unpacking libcrypt1:s390x (1:4.4.33-2) over (1:4.4.33-1) ... Setting up libcrypt1:s390x (1:4.4.33-2) ... (Reading database ... 12875 files and directories currently installed.) Preparing to unpack .../linux-libc-dev_6.1.0-16.16_s390x.deb ... Unpacking linux-libc-dev:s390x (6.1.0-16.16) over (5.19.0-21.21) ... Preparing to unpack .../libc6_2.37-0ubuntu2_s390x.deb ... Unpacking libc6:s390x (2.37-0ubuntu2) over (2.36-0ubuntu4) ... Setting up libc6:s390x (2.37-0ubuntu2) ... (Reading database ... 14905 files and directories currently installed.) Preparing to unpack .../libc-bin_2.37-0ubuntu2_s390x.deb ... Unpacking libc-bin (2.37-0ubuntu2) over (2.36-0ubuntu4) ... Setting up libc-bin (2.37-0ubuntu2) ... Selecting previously unselected package gcc-13-base:s390x. (Reading database ... 14905 files and directories currently installed.) Preparing to unpack .../gcc-13-base_13-20230305-1ubuntu1_s390x.deb ... Unpacking gcc-13-base:s390x (13-20230305-1ubuntu1) ... Setting up gcc-13-base:s390x (13-20230305-1ubuntu1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libgcc-s1_13-20230305-1ubuntu1_s390x.deb ... Unpacking libgcc-s1:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Setting up libgcc-s1:s390x (13-20230305-1ubuntu1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../liblzma5_5.4.1-0.2_s390x.deb ... Unpacking liblzma5:s390x (5.4.1-0.2) over (5.2.9-0.0) ... Setting up liblzma5:s390x (5.4.1-0.2) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libgcrypt20_1.10.1-3ubuntu1_s390x.deb ... Unpacking libgcrypt20:s390x (1.10.1-3ubuntu1) over (1.10.1-2ubuntu1) ... Setting up libgcrypt20:s390x (1.10.1-3ubuntu1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libstdc++6_13-20230305-1ubuntu1_s390x.deb ... Unpacking libstdc++6:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Setting up libstdc++6:s390x (13-20230305-1ubuntu1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libacl1_2.3.1-3_s390x.deb ... Unpacking libacl1:s390x (2.3.1-3) over (2.3.1-2) ... Setting up libacl1:s390x (2.3.1-3) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libapparmor1_3.0.8-1ubuntu2_s390x.deb ... Unpacking libapparmor1:s390x (3.0.8-1ubuntu2) over (3.0.8-1ubuntu1) ... Preparing to unpack .../libaudit-common_1%3a3.0.9-1_all.deb ... Unpacking libaudit-common (1:3.0.9-1) over (1:3.0.7-1ubuntu3) ... Setting up libaudit-common (1:3.0.9-1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libcap-ng0_0.8.3-1build2_s390x.deb ... Unpacking libcap-ng0:s390x (0.8.3-1build2) over (0.8.3-1build1) ... Setting up libcap-ng0:s390x (0.8.3-1build2) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a3.0.9-1_s390x.deb ... Unpacking libaudit1:s390x (1:3.0.9-1) over (1:3.0.7-1ubuntu3) ... Setting up libaudit1:s390x (1:3.0.9-1) ... (Reading database ... 14910 files and directories currently installed.) Preparing to unpack .../libcap2_1%3a2.66-3ubuntu2_s390x.deb ... Unpacking libcap2:s390x (1:2.66-3ubuntu2) over (1:2.44-1build3) ... Setting up libcap2:s390x (1:2.66-3ubuntu2) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../libperl5.36_5.36.0-7_s390x.deb ... Unpacking libperl5.36:s390x (5.36.0-7) over (5.36.0-4ubuntu2) ... Preparing to unpack .../perl_5.36.0-7_s390x.deb ... Unpacking perl (5.36.0-7) over (5.36.0-4ubuntu2) ... Preparing to unpack .../perl-base_5.36.0-7_s390x.deb ... Unpacking perl-base (5.36.0-7) over (5.36.0-4ubuntu2) ... Setting up perl-base (5.36.0-7) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../perl-modules-5.36_5.36.0-7_all.deb ... Unpacking perl-modules-5.36 (5.36.0-7) over (5.36.0-4ubuntu2) ... Preparing to unpack .../libdb5.3_5.3.28+dfsg2-1_s390x.deb ... Unpacking libdb5.3:s390x (5.3.28+dfsg2-1) over (5.3.28+dfsg1-0.10) ... Setting up libdb5.3:s390x (5.3.28+dfsg2-1) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../zlib1g_1%3a1.2.13.dfsg-1ubuntu4_s390x.deb ... Unpacking zlib1g:s390x (1:1.2.13.dfsg-1ubuntu4) over (1:1.2.11.dfsg-4.1ubuntu1) ... Setting up zlib1g:s390x (1:1.2.13.dfsg-1ubuntu4) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../debconf_1.5.82_all.deb ... Unpacking debconf (1.5.82) over (1.5.79ubuntu1) ... Setting up debconf (1.5.82) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../libssl3_3.0.8-1ubuntu1_s390x.deb ... Unpacking libssl3:s390x (3.0.8-1ubuntu1) over (3.0.5-2ubuntu2) ... Preparing to unpack .../libzstd1_1.5.4+dfsg2-4_s390x.deb ... Unpacking libzstd1:s390x (1.5.4+dfsg2-4) over (1.5.2+dfsg-1) ... Setting up libzstd1:s390x (1.5.4+dfsg2-4) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../libkmod2_30+20221128-1ubuntu1_s390x.deb ... Unpacking libkmod2:s390x (30+20221128-1ubuntu1) over (30+20220905-1ubuntu1) ... Preparing to unpack .../libseccomp2_2.5.4-1ubuntu3_s390x.deb ... Unpacking libseccomp2:s390x (2.5.4-1ubuntu3) over (2.5.4-1ubuntu2) ... Setting up libseccomp2:s390x (2.5.4-1ubuntu3) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../libpcre2-8-0_10.42-1_s390x.deb ... Unpacking libpcre2-8-0:s390x (10.42-1) over (10.40-1ubuntu1) ... Setting up libpcre2-8-0:s390x (10.42-1) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../libselinux1_3.4-1build4_s390x.deb ... Unpacking libselinux1:s390x (3.4-1build4) over (3.4-1build1) ... Setting up libselinux1:s390x (3.4-1build4) ... (Reading database ... 14912 files and directories currently installed.) Preparing to unpack .../systemd-sysv_252.5-2ubuntu2_s390x.deb ... Unpacking systemd-sysv (252.5-2ubuntu2) over (251.4-1ubuntu7) ... Setting up libssl3:s390x (3.0.8-1ubuntu1) ... (Reading database ... 14913 files and directories currently installed.) Preparing to unpack .../systemd_252.5-2ubuntu2_s390x.deb ... Unpacking systemd (252.5-2ubuntu2) over (251.4-1ubuntu7) ... Preparing to unpack .../libsystemd-shared_252.5-2ubuntu2_s390x.deb ... Unpacking libsystemd-shared:s390x (252.5-2ubuntu2) over (251.4-1ubuntu7) ... Preparing to unpack .../libcryptsetup12_2%3a2.6.1-1ubuntu1_s390x.deb ... Unpacking libcryptsetup12:s390x (2:2.6.1-1ubuntu1) over (2:2.5.0-6ubuntu3) ... Preparing to unpack .../libp11-kit0_0.24.1-2ubuntu1_s390x.deb ... Unpacking libp11-kit0:s390x (0.24.1-2ubuntu1) over (0.24.1-1ubuntu2) ... Setting up libp11-kit0:s390x (0.24.1-2ubuntu1) ... (Reading database ... 14929 files and directories currently installed.) Preparing to unpack .../libsystemd0_252.5-2ubuntu2_s390x.deb ... Unpacking libsystemd0:s390x (252.5-2ubuntu2) over (251.4-1ubuntu7) ... Setting up libsystemd0:s390x (252.5-2ubuntu2) ... (Reading database ... 14930 files and directories currently installed.) Preparing to unpack .../libudev1_252.5-2ubuntu2_s390x.deb ... Unpacking libudev1:s390x (252.5-2ubuntu2) over (251.4-1ubuntu7) ... Setting up libudev1:s390x (252.5-2ubuntu2) ... (Reading database ... 14931 files and directories currently installed.) Preparing to unpack .../libapt-pkg6.0_2.6.0_s390x.deb ... Unpacking libapt-pkg6.0:s390x (2.6.0) over (2.5.4) ... Setting up libapt-pkg6.0:s390x (2.6.0) ... (Reading database ... 14931 files and directories currently installed.) Preparing to unpack .../dpkg_1.21.21ubuntu1_s390x.deb ... Unpacking dpkg (1.21.21ubuntu1) over (1.21.11ubuntu2) ... Setting up dpkg (1.21.21ubuntu1) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../dash_0.5.12-2ubuntu1_s390x.deb ... Unpacking dash (0.5.12-2ubuntu1) over (0.5.11+git20210903+057cd650a4ed-9ubuntu1) ... Setting up dash (0.5.12-2ubuntu1) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../diffutils_1%3a3.8-4_s390x.deb ... Unpacking diffutils (1:3.8-4) over (1:3.8-1) ... Setting up diffutils (1:3.8-4) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../archives/grep_3.8-5_s390x.deb ... Unpacking grep (3.8-5) over (3.8-3) ... Setting up grep (3.8-5) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../hostname_3.23+nmu1ubuntu1_s390x.deb ... Unpacking hostname (3.23+nmu1ubuntu1) over (3.23ubuntu2) ... Setting up hostname (3.23+nmu1ubuntu1) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../ncurses-bin_6.4-2_s390x.deb ... Unpacking ncurses-bin (6.4-2) over (6.3+20220423-2) ... Setting up ncurses-bin (6.4-2) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../archives/sed_4.9-1_s390x.deb ... Unpacking sed (4.9-1) over (4.8-1ubuntu2) ... Setting up sed (4.9-1) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../ncurses-base_6.4-2_all.deb ... Unpacking ncurses-base (6.4-2) over (6.3+20220423-2) ... Setting up ncurses-base (6.4-2) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../archives/lsb-base_11.6_all.deb ... Unpacking lsb-base (11.6) over (11.2ubuntu1) ... Preparing to unpack .../sysvinit-utils_3.06-2ubuntu1_s390x.deb ... Unpacking sysvinit-utils (3.06-2ubuntu1) over (3.04-1ubuntu1) ... Setting up sysvinit-utils (3.06-2ubuntu1) ... (Reading database ... 14934 files and directories currently installed.) Preparing to unpack .../adduser_3.129ubuntu1_all.deb ... moving unchanged adduser.conf to adduser.conf.update-old. New dpkg-conffile will come from the package. Unpacking adduser (3.129ubuntu1) over (3.121ubuntu1) ... Setting up adduser (3.129ubuntu1) ... Installing new version of config file /etc/deluser.conf ... (Reading database ... 14901 files and directories currently installed.) Preparing to unpack .../gpgv_2.2.40-1ubuntu2_s390x.deb ... Unpacking gpgv (2.2.40-1ubuntu2) over (2.2.40-1ubuntu1) ... Setting up gpgv (2.2.40-1ubuntu2) ... (Reading database ... 14901 files and directories currently installed.) Preparing to unpack .../libgnutls30_3.7.8-5ubuntu1_s390x.deb ... Unpacking libgnutls30:s390x (3.7.8-5ubuntu1) over (3.7.7-2ubuntu2) ... Setting up libgnutls30:s390x (3.7.8-5ubuntu1) ... (Reading database ... 14901 files and directories currently installed.) Preparing to unpack .../archives/apt_2.6.0_s390x.deb ... Unpacking apt (2.6.0) over (2.5.4) ... Setting up apt (2.6.0) ... Installing new version of config file /etc/apt/apt.conf.d/01autoremove ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../logsave_1.47.0-1ubuntu1_s390x.deb ... Unpacking logsave (1.47.0-1ubuntu1) over (1.46.6~rc1-1ubuntu1) ... Preparing to unpack .../libext2fs2_1.47.0-1ubuntu1_s390x.deb ... Unpacking libext2fs2:s390x (1.47.0-1ubuntu1) over (1.46.6~rc1-1ubuntu1) ... Setting up libext2fs2:s390x (1.47.0-1ubuntu1) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../e2fsprogs_1.47.0-1ubuntu1_s390x.deb ... Unpacking e2fsprogs (1.47.0-1ubuntu1) over (1.46.6~rc1-1ubuntu1) ... Preparing to unpack .../libattr1_1%3a2.5.1-4_s390x.deb ... Unpacking libattr1:s390x (1:2.5.1-4) over (1:2.5.1-3) ... Setting up libattr1:s390x (1:2.5.1-4) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../libdebconfclient0_0.267ubuntu1_s390x.deb ... Unpacking libdebconfclient0:s390x (0.267ubuntu1) over (0.264ubuntu1) ... Setting up libdebconfclient0:s390x (0.267ubuntu1) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../libsemanage-common_3.4-1build4_all.deb ... Unpacking libsemanage-common (3.4-1build4) over (3.4-1build1) ... Setting up libsemanage-common (3.4-1build4) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../libsemanage2_3.4-1build4_s390x.deb ... Unpacking libsemanage2:s390x (3.4-1build4) over (3.4-1build1) ... Setting up libsemanage2:s390x (3.4-1build4) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../libncurses6_6.4-2_s390x.deb ... Unpacking libncurses6:s390x (6.4-2) over (6.3+20220423-2) ... Preparing to unpack .../libncursesw6_6.4-2_s390x.deb ... Unpacking libncursesw6:s390x (6.4-2) over (6.3+20220423-2) ... Preparing to unpack .../libtinfo6_6.4-2_s390x.deb ... Unpacking libtinfo6:s390x (6.4-2) over (6.3+20220423-2) ... Setting up libtinfo6:s390x (6.4-2) ... (Reading database ... 14902 files and directories currently installed.) Preparing to unpack .../00-libcom-err2_1.47.0-1ubuntu1_s390x.deb ... Unpacking libcom-err2:s390x (1.47.0-1ubuntu1) over (1.46.6~rc1-1ubuntu1) ... Selecting previously unselected package libproc2-0:s390x. Preparing to unpack .../01-libproc2-0_2%3a4.0.3-1ubuntu1_s390x.deb ... Unpacking libproc2-0:s390x (2:4.0.3-1ubuntu1) ... Preparing to unpack .../02-libss2_1.47.0-1ubuntu1_s390x.deb ... Unpacking libss2:s390x (1.47.0-1ubuntu1) over (1.46.6~rc1-1ubuntu1) ... Preparing to unpack .../03-procps_2%3a4.0.3-1ubuntu1_s390x.deb ... Unpacking procps (2:4.0.3-1ubuntu1) over (2:3.3.17-7ubuntu1) ... Preparing to unpack .../04-sensible-utils_0.0.17+nmu1_all.deb ... Unpacking sensible-utils (0.0.17+nmu1) over (0.0.17) ... Preparing to unpack .../05-openssl_3.0.8-1ubuntu1_s390x.deb ... Unpacking openssl (3.0.8-1ubuntu1) over (3.0.5-2ubuntu2) ... Preparing to unpack .../06-ca-certificates_20230311_all.deb ... Unpacking ca-certificates (20230311) over (20211016ubuntu1) ... Preparing to unpack .../07-readline-common_8.2-1.3_all.deb ... Unpacking readline-common (8.2-1.3) over (8.2-1.2) ... Preparing to unpack .../08-libreadline8_8.2-1.3_s390x.deb ... Unpacking libreadline8:s390x (8.2-1.3) over (8.2-1.2) ... Preparing to unpack .../09-libsqlite3-0_3.40.1-1_s390x.deb ... Unpacking libsqlite3-0:s390x (3.40.1-1) over (3.40.0-1) ... Preparing to unpack .../10-tzdata_2022g-7ubuntu2_all.deb ... Unpacking tzdata (2022g-7ubuntu2) over (2022g-1ubuntu1) ... Preparing to unpack .../11-xz-utils_5.4.1-0.2_s390x.deb ... Unpacking xz-utils (5.4.1-0.2) over (5.2.9-0.0) ... Preparing to unpack .../12-advancecomp_2.5-1_s390x.deb ... Unpacking advancecomp (2.5-1) over (2.4-1) ... Preparing to unpack .../13-libctf0_2.40-2ubuntu3_s390x.deb ... Unpacking libctf0:s390x (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../14-libctf-nobfd0_2.40-2ubuntu3_s390x.deb ... Unpacking libctf-nobfd0:s390x (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../15-binutils-s390x-linux-gnu_2.40-2ubuntu3_s390x.deb ... Unpacking binutils-s390x-linux-gnu (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../16-libbinutils_2.40-2ubuntu3_s390x.deb ... Unpacking libbinutils:s390x (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../17-binutils_2.40-2ubuntu3_s390x.deb ... Unpacking binutils (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../18-binutils-common_2.40-2ubuntu3_s390x.deb ... Unpacking binutils-common:s390x (2.40-2ubuntu3) over (2.39.50.20221224-1ubuntu1) ... Preparing to unpack .../19-libmpfr6_4.2.0-1_s390x.deb ... Unpacking libmpfr6:s390x (4.2.0-1) over (4.1.0-3build3) ... Preparing to unpack .../20-g++-12_12.2.0-17ubuntu1_s390x.deb ... Unpacking g++-12 (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../21-gcc-12_12.2.0-17ubuntu1_s390x.deb ... Unpacking gcc-12 (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../22-cpp-12_12.2.0-17ubuntu1_s390x.deb ... Unpacking cpp-12 (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../23-libubsan1_13-20230305-1ubuntu1_s390x.deb ... Unpacking libubsan1:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../24-libgomp1_13-20230305-1ubuntu1_s390x.deb ... Unpacking libgomp1:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../25-libitm1_13-20230305-1ubuntu1_s390x.deb ... Unpacking libitm1:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../26-libatomic1_13-20230305-1ubuntu1_s390x.deb ... Unpacking libatomic1:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../27-libasan8_13-20230305-1ubuntu1_s390x.deb ... Unpacking libasan8:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../28-libstdc++-12-dev_12.2.0-17ubuntu1_s390x.deb ... Unpacking libstdc++-12-dev:s390x (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../29-libgcc-12-dev_12.2.0-17ubuntu1_s390x.deb ... Unpacking libgcc-12-dev:s390x (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../30-libcc1-0_13-20230305-1ubuntu1_s390x.deb ... Unpacking libcc1-0:s390x (13-20230305-1ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../31-gcc-12-base_12.2.0-17ubuntu1_s390x.deb ... Unpacking gcc-12-base:s390x (12.2.0-17ubuntu1) over (12.2.0-10ubuntu1) ... Preparing to unpack .../32-g++_4%3a12.2.0-3ubuntu1_s390x.deb ... Unpacking g++ (4:12.2.0-3ubuntu1) over (4:12.2.0-1ubuntu1) ... Preparing to unpack .../33-gcc_4%3a12.2.0-3ubuntu1_s390x.deb ... Unpacking gcc (4:12.2.0-3ubuntu1) over (4:12.2.0-1ubuntu1) ... Preparing to unpack .../34-cpp_4%3a12.2.0-3ubuntu1_s390x.deb ... Unpacking cpp (4:12.2.0-3ubuntu1) over (4:12.2.0-1ubuntu1) ... Preparing to unpack .../35-dpkg-dev_1.21.21ubuntu1_all.deb ... Unpacking dpkg-dev (1.21.21ubuntu1) over (1.21.11ubuntu2) ... Preparing to unpack .../36-libdpkg-perl_1.21.21ubuntu1_all.deb ... Unpacking libdpkg-perl (1.21.21ubuntu1) over (1.21.11ubuntu2) ... Preparing to unpack .../37-lto-disabled-list_38_all.deb ... Unpacking lto-disabled-list (38) over (37) ... Preparing to unpack .../38-libfakeroot_1.31-1.1_s390x.deb ... Unpacking libfakeroot:s390x (1.31-1.1) over (1.30.1-1ubuntu1) ... Preparing to unpack .../39-fakeroot_1.31-1.1_s390x.deb ... Unpacking fakeroot (1.31-1.1) over (1.30.1-1ubuntu1) ... Preparing to unpack .../40-gpg_2.2.40-1ubuntu2_s390x.deb ... Unpacking gpg (2.2.40-1ubuntu2) over (2.2.40-1ubuntu1) ... Preparing to unpack .../41-gpgconf_2.2.40-1ubuntu2_s390x.deb ... Unpacking gpgconf (2.2.40-1ubuntu2) over (2.2.40-1ubuntu1) ... Preparing to unpack .../42-gpg-agent_2.2.40-1ubuntu2_s390x.deb ... Unpacking gpg-agent (2.2.40-1ubuntu2) over (2.2.40-1ubuntu1) ... Preparing to unpack .../43-pkgbinarymangler_152_all.deb ... Unpacking pkgbinarymangler (152) over (149) ... Setting up lsb-base (11.6) ... Setting up lto-disabled-list (38) ... Setting up libapparmor1:s390x (3.0.8-1ubuntu2) ... Setting up libsqlite3-0:s390x (3.40.1-1) ... Setting up binutils-common:s390x (2.40-2ubuntu3) ... Setting up linux-libc-dev:s390x (6.1.0-16.16) ... Setting up libctf-nobfd0:s390x (2.40-2ubuntu3) ... Setting up libcom-err2:s390x (1.47.0-1ubuntu1) ... Setting up libgomp1:s390x (13-20230305-1ubuntu1) ... Setting up libfakeroot:s390x (1.31-1.1) ... Setting up gcc-12-base:s390x (12.2.0-17ubuntu1) ... Setting up tzdata (2022g-7ubuntu2) ... Current default time zone: 'Etc/UTC' Local time is now: Mon Mar 20 11:16:14 UTC 2023. Universal Time is now: Mon Mar 20 11:16:14 UTC 2023. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up fakeroot (1.31-1.1) ... Setting up perl-modules-5.36 (5.36.0-7) ... Setting up libmpfr6:s390x (4.2.0-1) ... Setting up libncurses6:s390x (6.4-2) ... Setting up xz-utils (5.4.1-0.2) ... Setting up libproc2-0:s390x (2:4.0.3-1ubuntu1) ... Setting up libatomic1:s390x (13-20230305-1ubuntu1) ... Setting up libss2:s390x (1.47.0-1ubuntu1) ... Setting up libncursesw6:s390x (6.4-2) ... Setting up logsave (1.47.0-1ubuntu1) ... Setting up libubsan1:s390x (13-20230305-1ubuntu1) ... Setting up advancecomp (2.5-1) ... Setting up sensible-utils (0.0.17+nmu1) ... Setting up libcrypt-dev:s390x (1:4.4.33-2) ... Setting up libasan8:s390x (13-20230305-1ubuntu1) ... Setting up procps (2:4.0.3-1ubuntu1) ... Setting up libcryptsetup12:s390x (2:2.6.1-1ubuntu1) ... Setting up libbinutils:s390x (2.40-2ubuntu3) ... Setting up libc-dev-bin (2.37-0ubuntu2) ... Setting up openssl (3.0.8-1ubuntu1) ... Installing new version of config file /etc/ssl/openssl.cnf ... Setting up readline-common (8.2-1.3) ... Setting up libcc1-0:s390x (13-20230305-1ubuntu1) ... Setting up libperl5.36:s390x (5.36.0-7) ... Setting up libitm1:s390x (13-20230305-1ubuntu1) ... Setting up libkmod2:s390x (30+20221128-1ubuntu1) ... Setting up libctf0:s390x (2.40-2ubuntu3) ... Setting up cpp-12 (12.2.0-17ubuntu1) ... Setting up binutils-s390x-linux-gnu (2.40-2ubuntu3) ... Setting up pkgbinarymangler (152) ... Setting up libreadline8:s390x (8.2-1.3) ... Setting up e2fsprogs (1.47.0-1ubuntu1) ... Installing new version of config file /etc/mke2fs.conf ... Setting up binutils (2.40-2ubuntu3) ... Setting up ca-certificates (20230311) ... Updating certificates in /etc/ssl/certs... rehash: warning: skipping ca-certificates.crt,it does not contain exactly one certificate or CRL 22 added, 6 removed; done. Setting up perl (5.36.0-7) ... Setting up libgcc-12-dev:s390x (12.2.0-17ubuntu1) ... Setting up libsystemd-shared:s390x (252.5-2ubuntu2) ... Setting up libdpkg-perl (1.21.21ubuntu1) ... Setting up cpp (4:12.2.0-3ubuntu1) ... Setting up gpgconf (2.2.40-1ubuntu2) ... Setting up libc6-dev:s390x (2.37-0ubuntu2) ... Setting up gpg (2.2.40-1ubuntu2) ... Setting up gpg-agent (2.2.40-1ubuntu2) ... Setting up libstdc++-12-dev:s390x (12.2.0-17ubuntu1) ... Setting up systemd (252.5-2ubuntu2) ... Installing new version of config file /etc/systemd/logind.conf ... Installing new version of config file /etc/systemd/system.conf ... Installing new version of config file /etc/systemd/user.conf ... Initializing machine ID from random generator. Setting up dpkg-dev (1.21.21ubuntu1) ... Setting up gcc-12 (12.2.0-17ubuntu1) ... Setting up g++-12 (12.2.0-17ubuntu1) ... Setting up systemd-sysv (252.5-2ubuntu2) ... Setting up gcc (4:12.2.0-3ubuntu1) ... Setting up g++ (4:12.2.0-3ubuntu1) ... Processing triggers for libc-bin (2.37-0ubuntu2) ... Processing triggers for debianutils (5.7-0.4) ... Processing triggers for ca-certificates (20230311) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-24606054 s390x lunar-proposed -c chroot:build-PACKAGEBUILD-24606054 --arch=s390x --dist=lunar-proposed --nolog ataqv_1.3.0+ds-2.dsc Initiating build PACKAGEBUILD-24606054 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 5.4.0-139-generic #156-Ubuntu SMP Fri Jan 20 17:27:47 UTC 2023 s390x sbuild (Debian sbuild) 0.79.0 (05 February 2020) on bos02-s390x-006.buildd +==============================================================================+ | ataqv 1.3.0+ds-2 (s390x) Mon, 20 Mar 2023 11:16:18 +0000 | +==============================================================================+ Package: ataqv Version: 1.3.0+ds-2 Source Version: 1.3.0+ds-2 Distribution: lunar-proposed Machine Architecture: s390x Host Architecture: s390x Build Architecture: s390x Build Type: any I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-24606054/chroot-autobuild' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-YQ3GvQ/resolver-2BRiBO' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- ataqv_1.3.0+ds-2.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/ataqv-YQ3GvQ/ataqv-1.3.0+ds' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-YQ3GvQ' with '<>' +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<>/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/<>/apt_archive ./ InRelease Get:2 copy:/<>/apt_archive ./ Release [957 B] Ign:3 copy:/<>/apt_archive ./ Release.gpg Get:4 copy:/<>/apt_archive ./ Sources [494 B] Get:5 copy:/<>/apt_archive ./ Packages [579 B] Fetched 2030 B in 0s (0 B/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu72 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libpipeline1 libpsl5 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librtmp1 libsasl2-2 libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0 libxml2 m4 man-db media-types node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf python3 python3-minimal python3.11 python3.11-minimal zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libboost1.74-doc libboost-atomic1.74-dev libboost-container1.74-dev libboost-context1.74-dev libboost-contract1.74-dev libboost-coroutine1.74-dev libboost-date-time1.74-dev libboost-exception1.74-dev libboost-fiber1.74-dev libboost-graph1.74-dev libboost-graph-parallel1.74-dev libboost-locale1.74-dev libboost-log1.74-dev libboost-math1.74-dev libboost-mpi1.74-dev libboost-mpi-python1.74-dev libboost-numpy1.74-dev libboost-program-options1.74-dev libboost-python1.74-dev libboost-random1.74-dev libboost-serialization1.74-dev libboost-stacktrace1.74-dev libboost-test1.74-dev libboost-thread1.74-dev libboost-timer1.74-dev libboost-type-erasure1.74-dev libboost-wave1.74-dev libboost1.74-tools-dev libmpfrc++-dev libntl-dev libboost-nowide1.74-dev libcurl4-doc libgnutls28-dev libidn-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libjs-html5shiv libmail-box-perl python3-doc python3-tk python3-venv python3.11-venv python3.11-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl javascript-common libldap-common publicsuffix libsasl2-modules libltdl-dev libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-chrono-dev libboost-chrono1.74-dev libboost-chrono1.74.0 libboost-filesystem-dev libboost-filesystem1.74-dev libboost-filesystem1.74.0 libboost-iostreams-dev libboost-iostreams1.74-dev libboost-iostreams1.74.0 libboost-regex1.74-dev libboost-regex1.74.0 libboost-system-dev libboost-system1.74-dev libboost-system1.74.0 libboost1.74-dev libbrotli1 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu72 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2 liblocale-gettext-perl liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses5-dev libnghttp2-14 libpipeline1 libpsl5 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librtmp1 libsasl2-2 libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0 libxml2 m4 man-db media-types node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf python3 python3-minimal python3.11 python3.11-minimal sbuild-build-depends-main-dummy zlib1g-dev 0 upgraded, 122 newly installed, 0 to remove and 0 not upgraded. Need to get 61.3 MB of archives. After this operation, 343 MB of additional disk space will be used. Get:1 copy:/<>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [796 B] Get:2 http://ftpmaster.internal/ubuntu lunar/main s390x liblocale-gettext-perl s390x 1.07-5 [15.4 kB] Get:3 http://ftpmaster.internal/ubuntu lunar/main s390x libpython3.11-minimal s390x 3.11.2-6 [831 kB] Get:4 http://ftpmaster.internal/ubuntu lunar/main s390x libexpat1 s390x 2.5.0-1 [81.6 kB] Get:5 http://ftpmaster.internal/ubuntu lunar/main s390x python3.11-minimal s390x 3.11.2-6 [2124 kB] Get:6 http://ftpmaster.internal/ubuntu lunar/main s390x python3-minimal s390x 3.11.2-1 [24.6 kB] Get:7 http://ftpmaster.internal/ubuntu lunar/main s390x media-types all 10.0.0 [25.8 kB] Get:8 http://ftpmaster.internal/ubuntu lunar/main s390x libpython3.11-stdlib s390x 3.11.2-6 [1875 kB] Get:9 http://ftpmaster.internal/ubuntu lunar/main s390x python3.11 s390x 3.11.2-6 [565 kB] Get:10 http://ftpmaster.internal/ubuntu lunar/main s390x libpython3-stdlib s390x 3.11.2-1 [7238 B] Get:11 http://ftpmaster.internal/ubuntu lunar/main s390x python3 s390x 3.11.2-1 [22.9 kB] Get:12 http://ftpmaster.internal/ubuntu lunar/main s390x libelf1 s390x 0.188-2.1 [56.7 kB] Get:13 http://ftpmaster.internal/ubuntu lunar/main s390x libicu72 s390x 72.1-3ubuntu1 [10.7 MB] Get:14 http://ftpmaster.internal/ubuntu lunar/main s390x libxml2 s390x 2.9.14+dfsg-1.1build2 [718 kB] Get:15 http://ftpmaster.internal/ubuntu lunar/main s390x bsdextrautils s390x 2.38.1-4ubuntu1 [71.3 kB] Get:16 http://ftpmaster.internal/ubuntu lunar/main s390x libmagic-mgc s390x 1:5.44-3 [296 kB] Get:17 http://ftpmaster.internal/ubuntu lunar/main s390x libmagic1 s390x 1:5.44-3 [84.5 kB] Get:18 http://ftpmaster.internal/ubuntu lunar/main s390x file s390x 1:5.44-3 [21.7 kB] Get:19 http://ftpmaster.internal/ubuntu lunar/main s390x gettext-base s390x 0.21-11 [36.4 kB] Get:20 http://ftpmaster.internal/ubuntu lunar/main s390x libuchardet0 s390x 0.0.7-1build2 [76.4 kB] Get:21 http://ftpmaster.internal/ubuntu lunar/main s390x groff-base s390x 1.22.4-10 [914 kB] Get:22 http://ftpmaster.internal/ubuntu lunar/main s390x libnghttp2-14 s390x 1.52.0-1 [70.9 kB] Get:23 http://ftpmaster.internal/ubuntu lunar/main s390x libpipeline1 s390x 1.5.7-1 [23.4 kB] Get:24 http://ftpmaster.internal/ubuntu lunar/main s390x libpsl5 s390x 0.21.2-1 [59.1 kB] Get:25 http://ftpmaster.internal/ubuntu lunar/main s390x man-db s390x 2.11.2-1 [1216 kB] Get:26 http://ftpmaster.internal/ubuntu lunar/main s390x m4 s390x 1.4.19-3 [243 kB] Get:27 http://ftpmaster.internal/ubuntu lunar/main s390x autoconf all 2.71-3 [339 kB] Get:28 http://ftpmaster.internal/ubuntu lunar/main s390x autotools-dev all 20220109.1 [44.9 kB] Get:29 http://ftpmaster.internal/ubuntu lunar/main s390x automake all 1:1.16.5-1.3 [558 kB] Get:30 http://ftpmaster.internal/ubuntu lunar/main s390x autopoint all 0.21-11 [420 kB] Get:31 http://ftpmaster.internal/ubuntu lunar/main s390x libdebhelper-perl all 13.11.4ubuntu3 [66.1 kB] Get:32 http://ftpmaster.internal/ubuntu lunar/main s390x libtool all 2.4.7-5 [166 kB] Get:33 http://ftpmaster.internal/ubuntu lunar/main s390x dh-autoreconf all 20 [16.1 kB] Get:34 http://ftpmaster.internal/ubuntu lunar/main s390x libarchive-zip-perl all 1.68-1 [90.2 kB] Get:35 http://ftpmaster.internal/ubuntu lunar/main s390x libsub-override-perl all 0.09-4 [8706 B] Get:36 http://ftpmaster.internal/ubuntu lunar/main s390x libfile-stripnondeterminism-perl all 1.13.1-1 [18.1 kB] Get:37 http://ftpmaster.internal/ubuntu lunar/main s390x dh-strip-nondeterminism all 1.13.1-1 [5362 B] Get:38 http://ftpmaster.internal/ubuntu lunar/main s390x libdw1 s390x 0.188-2.1 [247 kB] Get:39 http://ftpmaster.internal/ubuntu lunar/main s390x debugedit s390x 1:5.0-5 [47.5 kB] Get:40 http://ftpmaster.internal/ubuntu lunar/main s390x dwz s390x 0.15-1 [108 kB] Get:41 http://ftpmaster.internal/ubuntu lunar/main s390x gettext s390x 0.21-11 [851 kB] Get:42 http://ftpmaster.internal/ubuntu lunar/main s390x intltool-debian all 0.35.0+20060710.6 [23.2 kB] Get:43 http://ftpmaster.internal/ubuntu lunar/main s390x po-debconf all 1.0.21+nmu1 [233 kB] Get:44 http://ftpmaster.internal/ubuntu lunar/main s390x debhelper all 13.11.4ubuntu3 [925 kB] Get:45 http://ftpmaster.internal/ubuntu lunar/main s390x fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] Get:46 http://ftpmaster.internal/ubuntu lunar/universe s390x help2man s390x 1.49.3 [201 kB] Get:47 http://ftpmaster.internal/ubuntu lunar/main s390x icu-devtools s390x 72.1-3ubuntu1 [208 kB] Get:48 http://ftpmaster.internal/ubuntu lunar/main s390x libboost1.74-dev s390x 1.74.0-18.1ubuntu3 [9588 kB] Get:49 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-chrono1.74.0 s390x 1.74.0-18.1ubuntu3 [230 kB] Get:50 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-chrono1.74-dev s390x 1.74.0-18.1ubuntu3 [236 kB] Get:51 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-chrono-dev s390x 1.74.0.3ubuntu7 [3856 B] Get:52 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-filesystem1.74.0 s390x 1.74.0-18.1ubuntu3 [261 kB] Get:53 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-system1.74.0 s390x 1.74.0-18.1ubuntu3 [220 kB] Get:54 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-system1.74-dev s390x 1.74.0-18.1ubuntu3 [218 kB] Get:55 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-filesystem1.74-dev s390x 1.74.0-18.1ubuntu3 [283 kB] Get:56 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-filesystem-dev s390x 1.74.0.3ubuntu7 [3282 B] Get:57 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-regex1.74.0 s390x 1.74.0-18.1ubuntu3 [490 kB] Get:58 http://ftpmaster.internal/ubuntu lunar/main s390x libicu-dev s390x 72.1-3ubuntu1 [11.7 MB] Get:59 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-regex1.74-dev s390x 1.74.0-18.1ubuntu3 [575 kB] Get:60 http://ftpmaster.internal/ubuntu lunar/main s390x libboost-iostreams1.74.0 s390x 1.74.0-18.1ubuntu3 [241 kB] Get:61 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-iostreams1.74-dev s390x 1.74.0-18.1ubuntu3 [249 kB] Get:62 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-iostreams-dev s390x 1.74.0.3ubuntu7 [3238 B] Get:63 http://ftpmaster.internal/ubuntu lunar/universe s390x libboost-system-dev s390x 1.74.0.3ubuntu7 [3390 B] Get:64 http://ftpmaster.internal/ubuntu lunar/main s390x libbrotli1 s390x 1.0.9-2build8 [312 kB] Get:65 http://ftpmaster.internal/ubuntu lunar/main s390x libsasl2-modules-db s390x 2.1.28+dfsg-10 [20.1 kB] Get:66 http://ftpmaster.internal/ubuntu lunar/main s390x libsasl2-2 s390x 2.1.28+dfsg-10 [57.1 kB] Get:67 http://ftpmaster.internal/ubuntu lunar/main s390x libldap2 s390x 2.6.3+dfsg-1~exp1ubuntu2 [179 kB] Get:68 http://ftpmaster.internal/ubuntu lunar/main s390x librtmp1 s390x 2.4+20151223.gitfa8646d.1-2build4 [56.4 kB] Get:69 http://ftpmaster.internal/ubuntu lunar/main s390x libssh-4 s390x 0.10.4-2 [173 kB] Get:70 http://ftpmaster.internal/ubuntu lunar/main s390x libcurl3-gnutls s390x 7.88.1-6ubuntu1 [293 kB] Get:71 http://ftpmaster.internal/ubuntu lunar/main s390x libcurl4-gnutls-dev s390x 7.88.1-6ubuntu1 [399 kB] Get:72 http://ftpmaster.internal/ubuntu lunar/main s390x libdeflate0 s390x 1.15-1 [36.6 kB] Get:73 http://ftpmaster.internal/ubuntu lunar/main s390x libdeflate-dev s390x 1.15-1 [43.5 kB] Get:74 http://ftpmaster.internal/ubuntu lunar/universe s390x libhtscodecs2 s390x 1.3.0-4 [74.8 kB] Get:75 http://ftpmaster.internal/ubuntu lunar/universe s390x libhts3 s390x 1.16+ds-3 [405 kB] Get:76 http://ftpmaster.internal/ubuntu lunar/main s390x liblzma-dev s390x 5.4.1-0.2 [175 kB] Get:77 http://ftpmaster.internal/ubuntu lunar/main s390x zlib1g-dev s390x 1:1.2.13.dfsg-1ubuntu4 [896 kB] Get:78 http://ftpmaster.internal/ubuntu lunar/universe s390x libhts-dev s390x 1.16+ds-3 [5595 kB] Get:79 http://ftpmaster.internal/ubuntu lunar/main s390x libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] Get:80 http://ftpmaster.internal/ubuntu lunar/universe s390x libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] Get:81 http://ftpmaster.internal/ubuntu lunar/universe s390x libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] Get:82 http://ftpmaster.internal/ubuntu lunar/main s390x libncurses-dev s390x 6.4-2 [374 kB] Get:83 http://ftpmaster.internal/ubuntu lunar/main s390x libncurses5-dev s390x 6.4-2 [784 B] Get:84 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] Get:85 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-axis all 1.0.12-5 [10.4 kB] Get:86 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-dispatch all 1.0.6-4 [8172 B] Get:87 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-selection all 1.4.0-8 [31.5 kB] Get:88 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-drag all 1.2.5-4 [14.3 kB] Get:89 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-color all 1.2.8-5 [15.6 kB] Get:90 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-interpolate all 1.4.0-4 [19.2 kB] Get:91 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-ease all 1.0.5-5 [10.3 kB] Get:92 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-timer all 1.0.10-3 [8818 B] Get:93 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-transition all 1.3.2-6 [22.7 kB] Get:94 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-brush all 1.1.5-4 [178 kB] Get:95 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-path all 1.0.9-4 [8532 B] Get:96 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-chord all 1.0.6-7 [10.4 kB] Get:97 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-collection all 1.0.7-5 [12.1 kB] Get:98 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-contour all 1.3.2-8 [14.5 kB] Get:99 http://ftpmaster.internal/ubuntu lunar/universe s390x node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] Get:100 http://ftpmaster.internal/ubuntu lunar/universe s390x node-iconv-lite all 0.6.3-3 [158 kB] Get:101 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-queue all 3.0.7-13 [10.2 kB] Get:102 http://ftpmaster.internal/ubuntu lunar/universe s390x node-rw all 1.3.3-5 [7570 B] Get:103 http://ftpmaster.internal/ubuntu lunar/universe s390x node-commander all 9.4.1-1 [50.6 kB] Get:104 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-dsv all 1.1.1-8 [13.7 kB] Get:105 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-fetch all 1.2.0-5 [7710 B] Get:106 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-quadtree all 1.0.7-4 [13.7 kB] Get:107 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-force all 1.2.1-5 [362 kB] Get:108 http://ftpmaster.internal/ubuntu lunar/universe s390x libjs-d3-format all 1:1.4.1-7 [17.6 kB] Get:109 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-format all 1:1.4.1-7 [7586 B] Get:110 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-geo all 1.11.9-6 [55.7 kB] Get:111 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-hierarchy all 1.1.8-6 [29.8 kB] Get:112 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-polygon all 1.0.5-5 [7710 B] Get:113 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-random all 1.1.2-5 [7526 B] Get:114 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-time all 1.0.11-6 [15.0 kB] Get:115 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-time-format all 2.1.3-7 [20.1 kB] Get:116 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-scale all 2.2.2-6 [32.0 kB] Get:117 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-scale-chromatic all 1.5.0-7 [20.7 kB] Get:118 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-shape all 1.3.7-5 [41.6 kB] Get:119 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-voronoi all 1.1.4-5 [18.0 kB] Get:120 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3-zoom all 1.8.3-4 [20.7 kB] Get:121 http://ftpmaster.internal/ubuntu lunar/universe s390x node-d3 all 5.16.0-10 [192 kB] Get:122 http://ftpmaster.internal/ubuntu lunar/universe s390x node-normalize.css all 8.0.1-5 [10.8 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 61.3 MB in 4s (14.8 MB/s) Selecting previously unselected package liblocale-gettext-perl. (Reading database ... 14383 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-5_s390x.deb ... Unpacking liblocale-gettext-perl (1.07-5) ... Selecting previously unselected package libpython3.11-minimal:s390x. Preparing to unpack .../libpython3.11-minimal_3.11.2-6_s390x.deb ... Unpacking libpython3.11-minimal:s390x (3.11.2-6) ... Selecting previously unselected package libexpat1:s390x. Preparing to unpack .../libexpat1_2.5.0-1_s390x.deb ... Unpacking libexpat1:s390x (2.5.0-1) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.2-6_s390x.deb ... Unpacking python3.11-minimal (3.11.2-6) ... Setting up libpython3.11-minimal:s390x (3.11.2-6) ... Setting up libexpat1:s390x (2.5.0-1) ... Setting up python3.11-minimal (3.11.2-6) ... Selecting previously unselected package python3-minimal. (Reading database ... 14711 files and directories currently installed.) Preparing to unpack .../python3-minimal_3.11.2-1_s390x.deb ... Unpacking python3-minimal (3.11.2-1) ... Selecting previously unselected package media-types. Preparing to unpack .../media-types_10.0.0_all.deb ... Unpacking media-types (10.0.0) ... Selecting previously unselected package libpython3.11-stdlib:s390x. Preparing to unpack .../libpython3.11-stdlib_3.11.2-6_s390x.deb ... Unpacking libpython3.11-stdlib:s390x (3.11.2-6) ... Selecting previously unselected package python3.11. Preparing to unpack .../python3.11_3.11.2-6_s390x.deb ... Unpacking python3.11 (3.11.2-6) ... Selecting previously unselected package libpython3-stdlib:s390x. Preparing to unpack .../libpython3-stdlib_3.11.2-1_s390x.deb ... Unpacking libpython3-stdlib:s390x (3.11.2-1) ... Setting up python3-minimal (3.11.2-1) ... Selecting previously unselected package python3. (Reading database ... 15119 files and directories currently installed.) Preparing to unpack .../000-python3_3.11.2-1_s390x.deb ... Unpacking python3 (3.11.2-1) ... Selecting previously unselected package libelf1:s390x. Preparing to unpack .../001-libelf1_0.188-2.1_s390x.deb ... Unpacking libelf1:s390x (0.188-2.1) ... Selecting previously unselected package libicu72:s390x. Preparing to unpack .../002-libicu72_72.1-3ubuntu1_s390x.deb ... Unpacking libicu72:s390x (72.1-3ubuntu1) ... Selecting previously unselected package libxml2:s390x. Preparing to unpack .../003-libxml2_2.9.14+dfsg-1.1build2_s390x.deb ... Unpacking libxml2:s390x (2.9.14+dfsg-1.1build2) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../004-bsdextrautils_2.38.1-4ubuntu1_s390x.deb ... Unpacking bsdextrautils (2.38.1-4ubuntu1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../005-libmagic-mgc_1%3a5.44-3_s390x.deb ... Unpacking libmagic-mgc (1:5.44-3) ... Selecting previously unselected package libmagic1:s390x. Preparing to unpack .../006-libmagic1_1%3a5.44-3_s390x.deb ... Unpacking libmagic1:s390x (1:5.44-3) ... Selecting previously unselected package file. Preparing to unpack .../007-file_1%3a5.44-3_s390x.deb ... Unpacking file (1:5.44-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../008-gettext-base_0.21-11_s390x.deb ... Unpacking gettext-base (0.21-11) ... Selecting previously unselected package libuchardet0:s390x. Preparing to unpack .../009-libuchardet0_0.0.7-1build2_s390x.deb ... Unpacking libuchardet0:s390x (0.0.7-1build2) ... Selecting previously unselected package groff-base. Preparing to unpack .../010-groff-base_1.22.4-10_s390x.deb ... Unpacking groff-base (1.22.4-10) ... Selecting previously unselected package libnghttp2-14:s390x. Preparing to unpack .../011-libnghttp2-14_1.52.0-1_s390x.deb ... Unpacking libnghttp2-14:s390x (1.52.0-1) ... Selecting previously unselected package libpipeline1:s390x. Preparing to unpack .../012-libpipeline1_1.5.7-1_s390x.deb ... Unpacking libpipeline1:s390x (1.5.7-1) ... Selecting previously unselected package libpsl5:s390x. Preparing to unpack .../013-libpsl5_0.21.2-1_s390x.deb ... Unpacking libpsl5:s390x (0.21.2-1) ... Selecting previously unselected package man-db. Preparing to unpack .../014-man-db_2.11.2-1_s390x.deb ... Unpacking man-db (2.11.2-1) ... Selecting previously unselected package m4. Preparing to unpack .../015-m4_1.4.19-3_s390x.deb ... Unpacking m4 (1.4.19-3) ... Selecting previously unselected package autoconf. Preparing to unpack .../016-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../017-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../018-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../019-autopoint_0.21-11_all.deb ... Unpacking autopoint (0.21-11) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../020-libdebhelper-perl_13.11.4ubuntu3_all.deb ... Unpacking libdebhelper-perl (13.11.4ubuntu3) ... Selecting previously unselected package libtool. Preparing to unpack .../021-libtool_2.4.7-5_all.deb ... Unpacking libtool (2.4.7-5) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../022-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../023-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../024-libsub-override-perl_0.09-4_all.deb ... Unpacking libsub-override-perl (0.09-4) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../025-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../026-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libdw1:s390x. Preparing to unpack .../027-libdw1_0.188-2.1_s390x.deb ... Unpacking libdw1:s390x (0.188-2.1) ... Selecting previously unselected package debugedit. Preparing to unpack .../028-debugedit_1%3a5.0-5_s390x.deb ... Unpacking debugedit (1:5.0-5) ... Selecting previously unselected package dwz. Preparing to unpack .../029-dwz_0.15-1_s390x.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package gettext. Preparing to unpack .../030-gettext_0.21-11_s390x.deb ... Unpacking gettext (0.21-11) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../031-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../032-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../033-debhelper_13.11.4ubuntu3_all.deb ... Unpacking debhelper (13.11.4ubuntu3) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../034-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Selecting previously unselected package help2man. Preparing to unpack .../035-help2man_1.49.3_s390x.deb ... Unpacking help2man (1.49.3) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../036-icu-devtools_72.1-3ubuntu1_s390x.deb ... Unpacking icu-devtools (72.1-3ubuntu1) ... Selecting previously unselected package libboost1.74-dev:s390x. Preparing to unpack .../037-libboost1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-chrono1.74.0:s390x. Preparing to unpack .../038-libboost-chrono1.74.0_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-chrono1.74.0:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-chrono1.74-dev:s390x. Preparing to unpack .../039-libboost-chrono1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-chrono1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-chrono-dev:s390x. Preparing to unpack .../040-libboost-chrono-dev_1.74.0.3ubuntu7_s390x.deb ... Unpacking libboost-chrono-dev:s390x (1.74.0.3ubuntu7) ... Selecting previously unselected package libboost-filesystem1.74.0:s390x. Preparing to unpack .../041-libboost-filesystem1.74.0_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-filesystem1.74.0:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-system1.74.0:s390x. Preparing to unpack .../042-libboost-system1.74.0_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-system1.74.0:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-system1.74-dev:s390x. Preparing to unpack .../043-libboost-system1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-system1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-filesystem1.74-dev:s390x. Preparing to unpack .../044-libboost-filesystem1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-filesystem1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-filesystem-dev:s390x. Preparing to unpack .../045-libboost-filesystem-dev_1.74.0.3ubuntu7_s390x.deb ... Unpacking libboost-filesystem-dev:s390x (1.74.0.3ubuntu7) ... Selecting previously unselected package libboost-regex1.74.0:s390x. Preparing to unpack .../046-libboost-regex1.74.0_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-regex1.74.0:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libicu-dev:s390x. Preparing to unpack .../047-libicu-dev_72.1-3ubuntu1_s390x.deb ... Unpacking libicu-dev:s390x (72.1-3ubuntu1) ... Selecting previously unselected package libboost-regex1.74-dev:s390x. Preparing to unpack .../048-libboost-regex1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-regex1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-iostreams1.74.0:s390x. Preparing to unpack .../049-libboost-iostreams1.74.0_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-iostreams1.74.0:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-iostreams1.74-dev:s390x. Preparing to unpack .../050-libboost-iostreams1.74-dev_1.74.0-18.1ubuntu3_s390x.deb ... Unpacking libboost-iostreams1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Selecting previously unselected package libboost-iostreams-dev:s390x. Preparing to unpack .../051-libboost-iostreams-dev_1.74.0.3ubuntu7_s390x.deb ... Unpacking libboost-iostreams-dev:s390x (1.74.0.3ubuntu7) ... Selecting previously unselected package libboost-system-dev:s390x. Preparing to unpack .../052-libboost-system-dev_1.74.0.3ubuntu7_s390x.deb ... Unpacking libboost-system-dev:s390x (1.74.0.3ubuntu7) ... Selecting previously unselected package libbrotli1:s390x. Preparing to unpack .../053-libbrotli1_1.0.9-2build8_s390x.deb ... Unpacking libbrotli1:s390x (1.0.9-2build8) ... Selecting previously unselected package libsasl2-modules-db:s390x. Preparing to unpack .../054-libsasl2-modules-db_2.1.28+dfsg-10_s390x.deb ... Unpacking libsasl2-modules-db:s390x (2.1.28+dfsg-10) ... Selecting previously unselected package libsasl2-2:s390x. Preparing to unpack .../055-libsasl2-2_2.1.28+dfsg-10_s390x.deb ... Unpacking libsasl2-2:s390x (2.1.28+dfsg-10) ... Selecting previously unselected package libldap2:s390x. Preparing to unpack .../056-libldap2_2.6.3+dfsg-1~exp1ubuntu2_s390x.deb ... Unpacking libldap2:s390x (2.6.3+dfsg-1~exp1ubuntu2) ... Selecting previously unselected package librtmp1:s390x. Preparing to unpack .../057-librtmp1_2.4+20151223.gitfa8646d.1-2build4_s390x.deb ... Unpacking librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build4) ... Selecting previously unselected package libssh-4:s390x. Preparing to unpack .../058-libssh-4_0.10.4-2_s390x.deb ... Unpacking libssh-4:s390x (0.10.4-2) ... Selecting previously unselected package libcurl3-gnutls:s390x. Preparing to unpack .../059-libcurl3-gnutls_7.88.1-6ubuntu1_s390x.deb ... Unpacking libcurl3-gnutls:s390x (7.88.1-6ubuntu1) ... Selecting previously unselected package libcurl4-gnutls-dev:s390x. Preparing to unpack .../060-libcurl4-gnutls-dev_7.88.1-6ubuntu1_s390x.deb ... Unpacking libcurl4-gnutls-dev:s390x (7.88.1-6ubuntu1) ... Selecting previously unselected package libdeflate0:s390x. Preparing to unpack .../061-libdeflate0_1.15-1_s390x.deb ... Unpacking libdeflate0:s390x (1.15-1) ... Selecting previously unselected package libdeflate-dev:s390x. Preparing to unpack .../062-libdeflate-dev_1.15-1_s390x.deb ... Unpacking libdeflate-dev:s390x (1.15-1) ... Selecting previously unselected package libhtscodecs2:s390x. Preparing to unpack .../063-libhtscodecs2_1.3.0-4_s390x.deb ... Unpacking libhtscodecs2:s390x (1.3.0-4) ... Selecting previously unselected package libhts3:s390x. Preparing to unpack .../064-libhts3_1.16+ds-3_s390x.deb ... Unpacking libhts3:s390x (1.16+ds-3) ... Selecting previously unselected package liblzma-dev:s390x. Preparing to unpack .../065-liblzma-dev_5.4.1-0.2_s390x.deb ... Unpacking liblzma-dev:s390x (5.4.1-0.2) ... Selecting previously unselected package zlib1g-dev:s390x. Preparing to unpack .../066-zlib1g-dev_1%3a1.2.13.dfsg-1ubuntu4_s390x.deb ... Unpacking zlib1g-dev:s390x (1:1.2.13.dfsg-1ubuntu4) ... Selecting previously unselected package libhts-dev:s390x. Preparing to unpack .../067-libhts-dev_1.16+ds-3_s390x.deb ... Unpacking libhts-dev:s390x (1.16+ds-3) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../068-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../069-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../070-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Selecting previously unselected package libncurses-dev:s390x. Preparing to unpack .../071-libncurses-dev_6.4-2_s390x.deb ... Unpacking libncurses-dev:s390x (6.4-2) ... Selecting previously unselected package libncurses5-dev:s390x. Preparing to unpack .../072-libncurses5-dev_6.4-2_s390x.deb ... Unpacking libncurses5-dev:s390x (6.4-2) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../073-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../074-node-d3-axis_1.0.12-5_all.deb ... Unpacking node-d3-axis (1.0.12-5) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../075-node-d3-dispatch_1.0.6-4_all.deb ... Unpacking node-d3-dispatch (1.0.6-4) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../076-node-d3-selection_1.4.0-8_all.deb ... Unpacking node-d3-selection (1.4.0-8) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../077-node-d3-drag_1.2.5-4_all.deb ... Unpacking node-d3-drag (1.2.5-4) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../078-node-d3-color_1.2.8-5_all.deb ... Unpacking node-d3-color (1.2.8-5) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../079-node-d3-interpolate_1.4.0-4_all.deb ... Unpacking node-d3-interpolate (1.4.0-4) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../080-node-d3-ease_1.0.5-5_all.deb ... Unpacking node-d3-ease (1.0.5-5) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../081-node-d3-timer_1.0.10-3_all.deb ... Unpacking node-d3-timer (1.0.10-3) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../082-node-d3-transition_1.3.2-6_all.deb ... Unpacking node-d3-transition (1.3.2-6) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../083-node-d3-brush_1.1.5-4_all.deb ... Unpacking node-d3-brush (1.1.5-4) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../084-node-d3-path_1.0.9-4_all.deb ... Unpacking node-d3-path (1.0.9-4) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../085-node-d3-chord_1.0.6-7_all.deb ... Unpacking node-d3-chord (1.0.6-7) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../086-node-d3-collection_1.0.7-5_all.deb ... Unpacking node-d3-collection (1.0.7-5) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../087-node-d3-contour_1.3.2-8_all.deb ... Unpacking node-d3-contour (1.3.2-8) ... Selecting previously unselected package node-safe-buffer. Preparing to unpack .../088-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... Selecting previously unselected package node-iconv-lite. Preparing to unpack .../089-node-iconv-lite_0.6.3-3_all.deb ... Unpacking node-iconv-lite (0.6.3-3) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../090-node-d3-queue_3.0.7-13_all.deb ... Unpacking node-d3-queue (3.0.7-13) ... Selecting previously unselected package node-rw. Preparing to unpack .../091-node-rw_1.3.3-5_all.deb ... Unpacking node-rw (1.3.3-5) ... Selecting previously unselected package node-commander. Preparing to unpack .../092-node-commander_9.4.1-1_all.deb ... Unpacking node-commander (9.4.1-1) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../093-node-d3-dsv_1.1.1-8_all.deb ... Unpacking node-d3-dsv (1.1.1-8) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../094-node-d3-fetch_1.2.0-5_all.deb ... Unpacking node-d3-fetch (1.2.0-5) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../095-node-d3-quadtree_1.0.7-4_all.deb ... Unpacking node-d3-quadtree (1.0.7-4) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../096-node-d3-force_1.2.1-5_all.deb ... Unpacking node-d3-force (1.2.1-5) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../097-libjs-d3-format_1%3a1.4.1-7_all.deb ... Unpacking libjs-d3-format (1:1.4.1-7) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../098-node-d3-format_1%3a1.4.1-7_all.deb ... Unpacking node-d3-format (1:1.4.1-7) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../099-node-d3-geo_1.11.9-6_all.deb ... Unpacking node-d3-geo (1.11.9-6) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../100-node-d3-hierarchy_1.1.8-6_all.deb ... Unpacking node-d3-hierarchy (1.1.8-6) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../101-node-d3-polygon_1.0.5-5_all.deb ... Unpacking node-d3-polygon (1.0.5-5) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../102-node-d3-random_1.1.2-5_all.deb ... Unpacking node-d3-random (1.1.2-5) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../103-node-d3-time_1.0.11-6_all.deb ... Unpacking node-d3-time (1.0.11-6) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../104-node-d3-time-format_2.1.3-7_all.deb ... Unpacking node-d3-time-format (2.1.3-7) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../105-node-d3-scale_2.2.2-6_all.deb ... Unpacking node-d3-scale (2.2.2-6) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../106-node-d3-scale-chromatic_1.5.0-7_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0-7) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../107-node-d3-shape_1.3.7-5_all.deb ... Unpacking node-d3-shape (1.3.7-5) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../108-node-d3-voronoi_1.1.4-5_all.deb ... Unpacking node-d3-voronoi (1.1.4-5) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../109-node-d3-zoom_1.8.3-4_all.deb ... Unpacking node-d3-zoom (1.8.3-4) ... Selecting previously unselected package node-d3. Preparing to unpack .../110-node-d3_5.16.0-10_all.deb ... Unpacking node-d3 (5.16.0-10) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../111-node-normalize.css_8.0.1-5_all.deb ... Unpacking node-normalize.css (8.0.1-5) ... Selecting previously unselected package sbuild-build-depends-main-dummy. Preparing to unpack .../112-sbuild-build-depends-main-dummy_0.invalid.0_s390x.deb ... Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ... Setting up libhtscodecs2:s390x (1.3.0-4) ... Setting up libboost-chrono1.74.0:s390x (1.74.0-18.1ubuntu3) ... Setting up media-types (10.0.0) ... Setting up libpipeline1:s390x (1.5.7-1) ... Setting up libboost-system1.74.0:s390x (1.74.0-18.1ubuntu3) ... Setting up node-d3-timer (1.0.10-3) ... Setting up node-d3-color (1.2.8-5) ... Setting up libncurses-dev:s390x (6.4-2) ... Setting up node-d3-interpolate (1.4.0-4) ... Setting up node-d3-queue (3.0.7-13) ... Setting up libpsl5:s390x (0.21.2-1) ... Setting up libboost1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up libicu72:s390x (72.1-3ubuntu1) ... Setting up bsdextrautils (2.38.1-4ubuntu1) ... Setting up node-d3-hierarchy (1.1.8-6) ... Setting up node-d3-ease (1.0.5-5) ... Setting up libmagic-mgc (1:5.44-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libboost-iostreams1.74.0:s390x (1.74.0-18.1ubuntu3) ... Setting up node-d3-scale-chromatic (1.5.0-7) ... Setting up libpython3.11-stdlib:s390x (3.11.2-6) ... Setting up libdebhelper-perl (13.11.4ubuntu3) ... Setting up libbrotli1:s390x (1.0.9-2build8) ... Setting up libboost-chrono1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up libnghttp2-14:s390x (1.52.0-1) ... Setting up libmagic1:s390x (1:5.44-3) ... Setting up libdeflate0:s390x (1.15-1) ... Setting up gettext-base (0.21-11) ... Setting up m4 (1.4.19-3) ... Setting up libboost-filesystem1.74.0:s390x (1.74.0-18.1ubuntu3) ... Setting up node-d3-selection (1.4.0-8) ... Setting up node-d3-axis (1.0.12-5) ... Setting up file (1:5.44-3) ... Setting up node-d3-path (1.0.9-4) ... Setting up libsasl2-modules-db:s390x (2.1.28+dfsg-10) ... Setting up autotools-dev (20220109.1) ... Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... Setting up node-rw (1.3.3-5) ... Setting up node-d3-polygon (1.0.5-5) ... Setting up node-d3-quadtree (1.0.7-4) ... Setting up librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build4) ... Setting up libboost-system1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up libboost-regex1.74.0:s390x (1.74.0-18.1ubuntu3) ... Setting up node-d3-collection (1.0.7-5) ... Setting up autopoint (0.21-11) ... Setting up icu-devtools (72.1-3ubuntu1) ... Setting up libsasl2-2:s390x (2.1.28+dfsg-10) ... Setting up libssh-4:s390x (0.10.4-2) ... Setting up autoconf (2.71-3) ... Setting up node-d3-voronoi (1.1.4-5) ... Setting up node-d3-dispatch (1.0.6-4) ... Setting up node-d3-time (1.0.11-6) ... Setting up liblzma-dev:s390x (5.4.1-0.2) ... Setting up zlib1g-dev:s390x (1:1.2.13.dfsg-1ubuntu4) ... Setting up node-commander (9.4.1-1) ... Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... Setting up libjs-d3-format (1:1.4.1-7) ... Setting up libuchardet0:s390x (0.0.7-1build2) ... Setting up libncurses5-dev:s390x (6.4-2) ... Setting up libsub-override-perl (0.09-4) ... Setting up libboost-filesystem1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up node-d3-geo (1.11.9-6) ... Setting up libdeflate-dev:s390x (1.15-1) ... Setting up node-normalize.css (8.0.1-5) ... Setting up node-d3-transition (1.3.2-6) ... Setting up libelf1:s390x (0.188-2.1) ... Setting up libicu-dev:s390x (72.1-3ubuntu1) ... Setting up libxml2:s390x (2.9.14+dfsg-1.1build2) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Setting up libldap2:s390x (2.6.3+dfsg-1~exp1ubuntu2) ... Setting up libboost-filesystem-dev:s390x (1.74.0.3ubuntu7) ... Setting up liblocale-gettext-perl (1.07-5) ... Setting up node-d3-random (1.1.2-5) ... Setting up libpython3-stdlib:s390x (3.11.2-1) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up python3.11 (3.11.2-6) ... Setting up libdw1:s390x (0.188-2.1) ... Setting up gettext (0.21-11) ... Setting up node-d3-format (1:1.4.1-7) ... Setting up libtool (2.4.7-5) ... Setting up libboost-chrono-dev:s390x (1.74.0.3ubuntu7) ... Setting up node-d3-time-format (2.1.3-7) ... Setting up libboost-system-dev:s390x (1.74.0.3ubuntu7) ... Setting up node-d3-chord (1.0.6-7) ... Setting up libcurl3-gnutls:s390x (7.88.1-6ubuntu1) ... Setting up python3 (3.11.2-1) ... Setting up libcurl4-gnutls-dev:s390x (7.88.1-6ubuntu1) ... Setting up node-d3-shape (1.3.7-5) ... Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up help2man (1.49.3) ... Setting up dh-autoreconf (20) ... Setting up node-d3-drag (1.2.5-4) ... Setting up node-iconv-lite (0.6.3-3) ... Setting up node-d3-scale (2.2.2-6) ... Setting up node-d3-force (1.2.1-5) ... Setting up node-d3-contour (1.3.2-8) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up libboost-regex1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up node-d3-brush (1.1.5-4) ... Setting up groff-base (1.22.4-10) ... Setting up debugedit (1:5.0-5) ... Setting up node-d3-dsv (1.1.1-8) ... Setting up libhts3:s390x (1.16+ds-3) ... Setting up node-d3-zoom (1.8.3-4) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhts-dev:s390x (1.16+ds-3) ... Setting up node-d3-fetch (1.2.0-5) ... Setting up node-d3 (5.16.0-10) ... Setting up man-db (2.11.2-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /lib/systemd/system/man-db.timer. Setting up libboost-iostreams1.74-dev:s390x (1.74.0-18.1ubuntu3) ... Setting up debhelper (13.11.4ubuntu3) ... Setting up libboost-iostreams-dev:s390x (1.74.0.3ubuntu7) ... Setting up sbuild-build-depends-main-dummy (0.invalid.0) ... Processing triggers for systemd (252.5-2ubuntu2) ... Processing triggers for libc-bin (2.37-0ubuntu2) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (s390x included in any) +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 5.4.0-139-generic #156-Ubuntu SMP Fri Jan 20 17:27:47 UTC 2023 s390x (s390x) Toolchain package versions: binutils_2.40-2ubuntu3 dpkg-dev_1.21.21ubuntu1 g++-12_12.2.0-17ubuntu1 gcc-12_12.2.0-17ubuntu1 libc6-dev_2.37-0ubuntu2 libstdc++-12-dev_12.2.0-17ubuntu1 libstdc++6_13-20230305-1ubuntu1 linux-libc-dev_6.1.0-16.16 Package versions: adduser_3.129ubuntu1 advancecomp_2.5-1 apt_2.6.0 autoconf_2.71-3 automake_1:1.16.5-1.3 autopoint_0.21-11 autotools-dev_20220109.1 base-files_12.3ubuntu1 base-passwd_3.6.1 bash_5.2.15-2ubuntu1 binutils_2.40-2ubuntu3 binutils-common_2.40-2ubuntu3 binutils-s390x-linux-gnu_2.40-2ubuntu3 bsdextrautils_2.38.1-4ubuntu1 bsdutils_1:2.38.1-4ubuntu1 build-essential_12.9ubuntu3 bzip2_1.0.8-5build1 ca-certificates_20230311 coreutils_9.1-1ubuntu2 cpp_4:12.2.0-3ubuntu1 cpp-12_12.2.0-17ubuntu1 dash_0.5.12-2ubuntu1 debconf_1.5.82 debhelper_13.11.4ubuntu3 debianutils_5.7-0.4 debugedit_1:5.0-5 dh-autoreconf_20 dh-strip-nondeterminism_1.13.1-1 diffutils_1:3.8-4 dpkg_1.21.21ubuntu1 dpkg-dev_1.21.21ubuntu1 dwz_0.15-1 e2fsprogs_1.47.0-1ubuntu1 fakeroot_1.31-1.1 file_1:5.44-3 findutils_4.9.0-3ubuntu1 fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1 g++_4:12.2.0-3ubuntu1 g++-12_12.2.0-17ubuntu1 gcc_4:12.2.0-3ubuntu1 gcc-12_12.2.0-17ubuntu1 gcc-12-base_12.2.0-17ubuntu1 gcc-13-base_13-20230305-1ubuntu1 gettext_0.21-11 gettext-base_0.21-11 gpg_2.2.40-1ubuntu2 gpg-agent_2.2.40-1ubuntu2 gpgconf_2.2.40-1ubuntu2 gpgv_2.2.40-1ubuntu2 grep_3.8-5 groff-base_1.22.4-10 gzip_1.12-1ubuntu1 help2man_1.49.3 hostname_3.23+nmu1ubuntu1 icu-devtools_72.1-3ubuntu1 init_1.65.2 init-system-helpers_1.65.2 intltool-debian_0.35.0+20060710.6 libacl1_2.3.1-3 libapparmor1_3.0.8-1ubuntu2 libapt-pkg6.0_2.6.0 libarchive-zip-perl_1.68-1 libargon2-1_0~20171227-0.3 libasan8_13-20230305-1ubuntu1 libassuan0_2.5.5-5 libatomic1_13-20230305-1ubuntu1 libattr1_1:2.5.1-4 libaudit-common_1:3.0.9-1 libaudit1_1:3.0.9-1 libbinutils_2.40-2ubuntu3 libblkid1_2.38.1-4ubuntu1 libboost-chrono-dev_1.74.0.3ubuntu7 libboost-chrono1.74-dev_1.74.0-18.1ubuntu3 libboost-chrono1.74.0_1.74.0-18.1ubuntu3 libboost-filesystem-dev_1.74.0.3ubuntu7 libboost-filesystem1.74-dev_1.74.0-18.1ubuntu3 libboost-filesystem1.74.0_1.74.0-18.1ubuntu3 libboost-iostreams-dev_1.74.0.3ubuntu7 libboost-iostreams1.74-dev_1.74.0-18.1ubuntu3 libboost-iostreams1.74.0_1.74.0-18.1ubuntu3 libboost-regex1.74-dev_1.74.0-18.1ubuntu3 libboost-regex1.74.0_1.74.0-18.1ubuntu3 libboost-system-dev_1.74.0.3ubuntu7 libboost-system1.74-dev_1.74.0-18.1ubuntu3 libboost-system1.74.0_1.74.0-18.1ubuntu3 libboost1.74-dev_1.74.0-18.1ubuntu3 libbrotli1_1.0.9-2build8 libbz2-1.0_1.0.8-5build1 libc-bin_2.37-0ubuntu2 libc-dev-bin_2.37-0ubuntu2 libc6_2.37-0ubuntu2 libc6-dev_2.37-0ubuntu2 libcap-ng0_0.8.3-1build2 libcap2_1:2.66-3ubuntu2 libcc1-0_13-20230305-1ubuntu1 libcom-err2_1.47.0-1ubuntu1 libcrypt-dev_1:4.4.33-2 libcrypt1_1:4.4.33-2 libcryptsetup12_2:2.6.1-1ubuntu1 libctf-nobfd0_2.40-2ubuntu3 libctf0_2.40-2ubuntu3 libcurl3-gnutls_7.88.1-6ubuntu1 libcurl4-gnutls-dev_7.88.1-6ubuntu1 libdb5.3_5.3.28+dfsg2-1 libdebconfclient0_0.267ubuntu1 libdebhelper-perl_13.11.4ubuntu3 libdeflate-dev_1.15-1 libdeflate0_1.15-1 libdevmapper1.02.1_2:1.02.185-1ubuntu1 libdpkg-perl_1.21.21ubuntu1 libdw1_0.188-2.1 libelf1_0.188-2.1 libexpat1_2.5.0-1 libext2fs2_1.47.0-1ubuntu1 libfakeroot_1.31-1.1 libfdisk1_2.38.1-4ubuntu1 libffi8_3.4.4-1 libfile-stripnondeterminism-perl_1.13.1-1 libgcc-12-dev_12.2.0-17ubuntu1 libgcc-s1_13-20230305-1ubuntu1 libgcrypt20_1.10.1-3ubuntu1 libgdbm-compat4_1.23-3 libgdbm6_1.23-3 libgmp10_2:6.2.1+dfsg1-1.1ubuntu1 libgnutls30_3.7.8-5ubuntu1 libgomp1_13-20230305-1ubuntu1 libgpg-error0_1.46-1 libgssapi-krb5-2_1.20.1-1build1 libhogweed6_3.8.1-2 libhts-dev_1.16+ds-3 libhts3_1.16+ds-3 libhtscodecs2_1.3.0-4 libicu-dev_72.1-3ubuntu1 libicu72_72.1-3ubuntu1 libidn2-0_2.3.3-1build1 libip4tc2_1.8.7-1ubuntu7 libisl23_0.25-1 libitm1_13-20230305-1ubuntu1 libjansson4_2.14-2 libjs-d3-format_1:1.4.1-7 libjs-jquery_3.6.1+dfsg+~3.5.14-1 libjs-jquery-datatables_1.11.5+dfsg-2 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5 libjson-c5_0.16-2 libk5crypto3_1.20.1-1build1 libkeyutils1_1.6.3-2 libkmod2_30+20221128-1ubuntu1 libkrb5-3_1.20.1-1build1 libkrb5support0_1.20.1-1build1 libldap2_2.6.3+dfsg-1~exp1ubuntu2 liblocale-gettext-perl_1.07-5 liblockfile-bin_1.17-1build2 liblockfile1_1.17-1build2 liblz4-1_1.9.4-1 liblzma-dev_5.4.1-0.2 liblzma5_5.4.1-0.2 libmagic-mgc_1:5.44-3 libmagic1_1:5.44-3 libmd0_1.0.4-2 libmount1_2.38.1-4ubuntu1 libmpc3_1.3.1-1 libmpfr6_4.2.0-1 libncurses-dev_6.4-2 libncurses5-dev_6.4-2 libncurses6_6.4-2 libncursesw6_6.4-2 libnettle8_3.8.1-2 libnghttp2-14_1.52.0-1 libnpth0_1.6-3build2 libnsl-dev_1.3.0-2build2 libnsl2_1.3.0-2build2 libp11-kit0_0.24.1-2ubuntu1 libpam-modules_1.5.2-5ubuntu1 libpam-modules-bin_1.5.2-5ubuntu1 libpam-runtime_1.5.2-5ubuntu1 libpam0g_1.5.2-5ubuntu1 libpcre2-8-0_10.42-1 libperl5.36_5.36.0-7 libpipeline1_1.5.7-1 libpng16-16_1.6.39-2 libproc2-0_2:4.0.3-1ubuntu1 libprocps8_2:3.3.17-7ubuntu1 libpsl5_0.21.2-1 libpython3-stdlib_3.11.2-1 libpython3.11-minimal_3.11.2-6 libpython3.11-stdlib_3.11.2-6 libreadline8_8.2-1.3 librtmp1_2.4+20151223.gitfa8646d.1-2build4 libsasl2-2_2.1.28+dfsg-10 libsasl2-modules-db_2.1.28+dfsg-10 libseccomp2_2.5.4-1ubuntu3 libselinux1_3.4-1build4 libsemanage-common_3.4-1build4 libsemanage2_3.4-1build4 libsepol2_3.4-2 libsmartcols1_2.38.1-4ubuntu1 libsqlite3-0_3.40.1-1 libss2_1.47.0-1ubuntu1 libssh-4_0.10.4-2 libssl3_3.0.8-1ubuntu1 libstdc++-12-dev_12.2.0-17ubuntu1 libstdc++6_13-20230305-1ubuntu1 libsub-override-perl_0.09-4 libsystemd-shared_252.5-2ubuntu2 libsystemd0_252.5-2ubuntu2 libtasn1-6_4.19.0-2 libtinfo6_6.4-2 libtirpc-common_1.3.3+ds-1 libtirpc-dev_1.3.3+ds-1 libtirpc3_1.3.3+ds-1 libtool_2.4.7-5 libubsan1_13-20230305-1ubuntu1 libuchardet0_0.0.7-1build2 libudev1_252.5-2ubuntu2 libunistring2_1.0-2 libuuid1_2.38.1-4ubuntu1 libxml2_2.9.14+dfsg-1.1build2 libxxhash0_0.8.1-1 libzstd1_1.5.4+dfsg2-4 linux-libc-dev_6.1.0-16.16 lockfile-progs_0.1.19build1 login_1:4.13+dfsg1-1ubuntu1 logsave_1.47.0-1ubuntu1 lsb-base_11.6 lto-disabled-list_38 m4_1.4.19-3 make_4.3-4.1build1 man-db_2.11.2-1 mawk_1.3.4.20200120-3.1 media-types_10.0.0 mount_2.38.1-4ubuntu1 ncurses-base_6.4-2 ncurses-bin_6.4-2 node-commander_9.4.1-1 node-d3_5.16.0-10 node-d3-array_3.2.0+~cs5.0.6-2 node-d3-axis_1.0.12-5 node-d3-brush_1.1.5-4 node-d3-chord_1.0.6-7 node-d3-collection_1.0.7-5 node-d3-color_1.2.8-5 node-d3-contour_1.3.2-8 node-d3-dispatch_1.0.6-4 node-d3-drag_1.2.5-4 node-d3-dsv_1.1.1-8 node-d3-ease_1.0.5-5 node-d3-fetch_1.2.0-5 node-d3-force_1.2.1-5 node-d3-format_1:1.4.1-7 node-d3-geo_1.11.9-6 node-d3-hierarchy_1.1.8-6 node-d3-interpolate_1.4.0-4 node-d3-path_1.0.9-4 node-d3-polygon_1.0.5-5 node-d3-quadtree_1.0.7-4 node-d3-queue_3.0.7-13 node-d3-random_1.1.2-5 node-d3-scale_2.2.2-6 node-d3-scale-chromatic_1.5.0-7 node-d3-selection_1.4.0-8 node-d3-shape_1.3.7-5 node-d3-time_1.0.11-6 node-d3-time-format_2.1.3-7 node-d3-timer_1.0.10-3 node-d3-transition_1.3.2-6 node-d3-voronoi_1.1.4-5 node-d3-zoom_1.8.3-4 node-iconv-lite_0.6.3-3 node-normalize.css_8.0.1-5 node-rw_1.3.3-5 node-safe-buffer_5.2.1+~cs2.1.2-3 openssl_3.0.8-1ubuntu1 optipng_0.7.7-2build1 passwd_1:4.13+dfsg1-1ubuntu1 patch_2.7.6-7build2 perl_5.36.0-7 perl-base_5.36.0-7 perl-modules-5.36_5.36.0-7 pinentry-curses_1.2.1-1ubuntu1 pkgbinarymangler_152 po-debconf_1.0.21+nmu1 policyrcd-script-zg2_0.1-3.1 procps_2:4.0.3-1ubuntu1 python3_3.11.2-1 python3-minimal_3.11.2-1 python3.11_3.11.2-6 python3.11-minimal_3.11.2-6 readline-common_8.2-1.3 rpcsvc-proto_1.4.2-0ubuntu6 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-1 sensible-utils_0.0.17+nmu1 systemd_252.5-2ubuntu2 systemd-sysv_252.5-2ubuntu2 sysvinit-utils_3.06-2ubuntu1 tar_1.34+dfsg-1.1 tzdata_2022g-7ubuntu2 ubuntu-keyring_2021.03.26 usrmerge_33ubuntu1 util-linux_2.38.1-4ubuntu1 util-linux-extra_2.38.1-4ubuntu1 xz-utils_5.4.1-0.2 zlib1g_1:1.2.13.dfsg-1ubuntu4 zlib1g-dev_1:1.2.13.dfsg-1ubuntu4 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: ataqv Binary: ataqv Architecture: any Version: 1.3.0+ds-2 Maintainer: Debian Med Packaging Team Uploaders: Michael R. Crusoe Homepage: https://github.com/ParkerLab/ataqv/ Standards-Version: 4.6.1 Vcs-Browser: https://salsa.debian.org/med-team/ataqv Vcs-Git: https://salsa.debian.org/med-team/ataqv.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper Package-List: ataqv deb science optional arch=any Checksums-Sha1: fc1bcceb4f034fb84eb89a9fdbd2d68870a0f676 4068000 ataqv_1.3.0+ds.orig.tar.xz dd3c0926a24b95504c3fa9332c2c3aea235f13f6 9216 ataqv_1.3.0+ds-2.debian.tar.xz Checksums-Sha256: 080d95e158275f4e23d49ed1bd2717790fdd764e6a4b3aa599ffad891eed7040 4068000 ataqv_1.3.0+ds.orig.tar.xz 15dda419acffae11446f4f276b50e8ba395448e83b108d7ae23f09761bb4672e 9216 ataqv_1.3.0+ds-2.debian.tar.xz Files: 3d49605d269fe61d2f600391c24d56b9 4068000 ataqv_1.3.0+ds.orig.tar.xz 791cfd07ba2e1f6f70f24088b92d97b1 9216 ataqv_1.3.0+ds-2.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmM2yKERHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtFwKQ/7BcdKxuuoSITw6d8J+rpTqL3mnsWW5/vr qgu4R602x67iQIx1IThpOqWnjmZUiGj7VTQ+qLDdk1CNGbbzLxjbUVS4QVA0066v zATRh3rsr3YMP+AySNA3OY9Jy2PeNc98WHejgo8HlHSs+8v1lqmoQ3pDq9uAGhWk QWT64JUc4BFYggLIr4lLdcMFiogwI5TnVwUPrhmglgm7mxMcJykhyxvTchlEYIO/ x3aON7qaYOmUWvH0WV7cMvnOX5VclpIJOYuTgs4J3dJjgg/RuO3clXkAWi3ihZx8 aF84xkRsMZnrWQm0Y1SOH7So8mkCxvK+RPS9yQGpcJRl1ltP29Ncr8Krf/SK4Ud3 q+hupAN9ZqFhCYgz3MNZV024bqnfSCoaWrL/E8g1Ua4ZN0eyvqd0B2fjKPmHgWLZ vjzF3r5hz++L/7TuljL/nboa6o26d9VWL1aLmKM3eEptTEkGtwhzvvmBB6ekQTdf miruBUeWKH/aCAWQWh+aKVD+JmgvXhg2S4Mex4wrqS/lvC1gYzLCw2AYF5uJ5gNN 2Qf14cwpixzqPicihumOsNRYJMXlfNJqNPwQbQMqfl1ax8hdryx8fP+IOWWvzxtN guPS53mqQp33ekLLxOLRsSEmnNOrWdNukEq6qRe6TCn713xxUpvtm92DQyPCi51F i+L/pKtu2us= =Gzra -----END PGP SIGNATURE----- gpgv: Signature made Fri Sep 30 10:44:49 2022 UTC gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.0+ds-2.dsc: no acceptable signature found dpkg-source: info: extracting ataqv in /<> dpkg-source: info: unpacking ataqv_1.3.0+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.3.0+ds-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-24606054 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-24606054 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-24606054 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- Command: dpkg-buildpackage -us -uc -mLaunchpad Build Daemon -B -rfakeroot dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.3.0+ds-2 dpkg-buildpackage: info: source distribution unstable dpkg-source --before-build . dpkg-buildpackage: info: host architecture s390x debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>' make[1]: Leaving directory '/<>' dh_clean debian/rules binary-arch dh binary-arch dh_update_autotools_config -a dh_autoreconf -a debian/rules override_dh_auto_configure make[1]: Entering directory '/<>' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/<>' debian/rules override_dh_auto_build make[1]: Entering directory '/<>' dh_auto_build -- all testing/run_ataqv_tests make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/<>' g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/ataqv.o -c /<>/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/Features.o -c /<>/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/HTS.o -c /<>/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/IO.o -c /<>/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/Metrics.o -c /<>/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/Peaks.o -c /<>/src/cpp/Peaks.cpp In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/bits/stl_algobase.h:64, from /usr/include/c++/12/algorithm:60, from /<>/src/cpp/ataqv.cpp:7: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ In file included from /<>/src/cpp/json.hpp:33, from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/ataqv.cpp:22: /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775808 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775745] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775745] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775807 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775806 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775805 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775804 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775803 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775802 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775801 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775800 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775799 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775798 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775797 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775796 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775795 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775794 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775808 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775807 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775806 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775805 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775804 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775803 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775802 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775801 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775800 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775799 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775798 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775797 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775796 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775795 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775794 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775760] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/Utils.o -c /<>/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /<>/src/cpp/run_ataqv_tests.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_features.o -c /<>/src/cpp/test_features.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_hts.o -c /<>/src/cpp/test_hts.cpp In file included from /<>/src/cpp/test_features.cpp:1: /<>/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /<>/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ In file included from /<>/src/cpp/test_hts.cpp:3: /<>/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_io.o -c /<>/src/cpp/test_io.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_metrics.o -c /<>/src/cpp/test_metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_peaks.o -c /<>/src/cpp/test_peaks.cpp In file included from /<>/src/cpp/test_metrics.cpp:3: /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: /<>/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: /<>/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: /<>/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ In file included from /<>/src/cpp/test_peaks.cpp:1: /<>/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /<>/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/exception_ptr.h:43, from /usr/include/c++/12/exception:168, from /usr/include/c++/12/ios:39, from /usr/include/c++/12/istream:38, from /usr/include/c++/12/sstream:38, from /<>/src/cpp/catch.hpp:74: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ In file included from /<>/src/cpp/json.hpp:33, from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/test_metrics.cpp:5: /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775808 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775745] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775745] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775807 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775806 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775805 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775804 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775803 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775802 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775801 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775800 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775799 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775798 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775797 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775796 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775795 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775794 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8273:14, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long unsigned int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8523:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775808 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775746] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775807 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775747] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775806 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775748] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775805 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775749] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775804 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775750] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775803 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775751] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775802 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775752] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775801 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775753] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775800 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775754] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775799 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775755] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775798 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775756] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775797 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775757] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775796 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775758] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775795 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775759] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:205:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 205 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset -9223372036854775794 into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = char]’, inlined from ‘void std::iter_swap(_ForwardIterator1, _ForwardIterator2) [with _ForwardIterator1 = char*; _ForwardIterator2 = char*]’ at /usr/include/c++/12/bits/stl_algobase.h:182:11, inlined from ‘void std::__reverse(_RandomAccessIterator, _RandomAccessIterator, random_access_iterator_tag) [with _RandomAccessIterator = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1107:18, inlined from ‘void std::reverse(_BIter, _BIter) [with _BIter = char*]’ at /usr/include/c++/12/bits/stl_algo.h:1134:21, inlined from ‘void nlohmann::basic_json::numtostr::x_write(NumberType, std::true_type) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8303:25, inlined from ‘nlohmann::basic_json::numtostr::numtostr(NumberType) [with NumberType = long int; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8260:20, inlined from ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:8517:22: /usr/include/c++/12/bits/move.h:206:11: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 206 | __b = _GLIBCXX_MOVE(__tmp); | ^ /usr/include/c++/12/array: In member function ‘void nlohmann::basic_json::dump(std::ostream&, bool, unsigned int, unsigned int) const [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /usr/include/c++/12/array:115:56: note: at offset [-9223372036854775808, -9223372036854775760] into destination object ‘std::array::_M_elems’ of size 64 115 | typename _AT_Type::_Type _M_elems; | ^~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/test_utils.o -c /<>/src/cpp/test_utils.cpp In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/tuple:38, from /usr/include/c++/12/mutex:38, from /usr/include/c++/12/future:38, from /<>/src/cpp/Metrics.cpp:10: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /<>/src/cpp/json.hpp:277:15: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long int, long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ In file included from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/Metrics.cpp:21: /<>/src/cpp/json.hpp: In static member function ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /<>/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /<>/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; = long double; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/12/bits/stl_construct.h:119:7, inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:120:21, inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/12/bits/stl_uninitialized.h:137:32, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1690:33, inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator >; = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:706:23, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector, std::allocator > >; _Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; _Tp = std::vector, std::allocator > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::vector, std::allocator > >; Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:332:77, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(is_compatible_array_type::value || std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:581:52, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector&; = std::vector; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const std::vector&; U = std::vector; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string; _U2 = std::vector; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type = true; _T1 = const std::__cxx11::basic_string; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_pair.h:439:29, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static void std::allocator_traits >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/alloc_traits.h:516:17, inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:595:32, inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:612:21, inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1636:32, inlined from ‘std::pair, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:2433:13, inlined from ‘std::__enable_if_t<(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value)> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1110:23, inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Tp = nlohmann::basic_json<>; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_map.h:285:31, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; _Tp = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:358:79, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if::value, int>::type = 0]’ at /<>/src/cpp/json.hpp:590:53, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map, std::vector >&; = std::map, std::vector >; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = std::map, std::vector >&; U = std::map, std::vector >; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /<>/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long int, long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /<>/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/Features.o -c /<>/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/HTS.o -c /<>/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/IO.o -c /<>/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/Metrics.o -c /<>/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/Peaks.o -c /<>/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/Utils.o -c /<>/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/tuple:38, from /usr/include/c++/12/mutex:38, from /usr/include/c++/12/future:38, from /<>/src/cpp/Metrics.cpp:10: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /<>/src/cpp/json.hpp:277:15: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long int, long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ In file included from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/Metrics.cpp:21: /<>/src/cpp/json.hpp: In static member function ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /<>/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /<>/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; = long double; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/12/bits/stl_construct.h:119:7, inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:120:21, inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/12/bits/stl_uninitialized.h:137:32, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1690:33, inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator >; = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:706:23, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector, std::allocator > >; _Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; _Tp = std::vector, std::allocator > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::vector, std::allocator > >; Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:332:77, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(is_compatible_array_type::value || std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:581:52, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector&; = std::vector; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const std::vector&; U = std::vector; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string; _U2 = std::vector; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type = true; _T1 = const std::__cxx11::basic_string; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_pair.h:439:29, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static void std::allocator_traits >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/alloc_traits.h:516:17, inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:595:32, inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:612:21, inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1636:32, inlined from ‘std::pair, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:2433:13, inlined from ‘std::__enable_if_t<(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value)> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1110:23, inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Tp = nlohmann::basic_json<>; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_map.h:285:31, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; _Tp = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /<>/src/cpp/json.hpp:358:79, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if::value, int>::type = 0]’ at /<>/src/cpp/json.hpp:590:53, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map, std::vector >&; = std::map, std::vector >; = void]’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = std::map, std::vector >&; U = std::map, std::vector >; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long int; NumberUnsignedType = long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /<>/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long int, long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /<>/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.0+ds-2 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/<>' make[1]: Leaving directory '/<>' dh_auto_test -a make -j4 test make[1]: Entering directory '/<>' ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ run_ataqv_tests is a Catch v1.5.7 host application. Run with -? for options ------------------------------------------------------------------------------- Test bad HTS record ------------------------------------------------------------------------------- ./src/cpp/test_hts.cpp:169 ............................................................................... ./src/cpp/test_hts.cpp:200: FAILED: REQUIRE_THROWS_AS( record_to_string(header, record) ) because no exception was thrown where one was expected: Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 1.67225 seconds. (14943.3 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 13.053 seconds. (2855.73 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 12.9471 seconds. (2879.09 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 12.624 seconds. (2952.849 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. =============================================================================== test cases: 54 | 53 passed | 1 failed assertions: 241 | 240 passed | 1 failed make[1]: *** [Makefile:187: test] Error 1 make[1]: Leaving directory '/<>' dh_auto_test: error: make -j4 test returned exit code 2 make: *** [debian/rules:12: binary-arch] Error 25 dpkg-buildpackage: error: debian/rules binary-arch subprocess returned exit status 2 -------------------------------------------------------------------------------- Build finished at 2023-03-20T11:18:03Z Finished -------- +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested E: Build failure (dpkg-buildpackage died) +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: s390x Build Type: any Build-Space: 121008 Build-Time: 89 Distribution: lunar-proposed Fail-Stage: build Host Architecture: s390x Install-Time: 16 Job: ataqv_1.3.0+ds-2.dsc Machine Architecture: s390x Package: ataqv Package-Time: 105 Source-Version: 1.3.0+ds-2 Space: 121008 Status: attempted Version: 1.3.0+ds-2 -------------------------------------------------------------------------------- Finished at 2023-03-20T11:18:03Z Build needed 00:01:45, 121008k disk space E: Build failure (dpkg-buildpackage died) RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=lunar --arch=s390x PACKAGEBUILD-24606054 Scanning for processes to kill in build PACKAGEBUILD-24606054