RUN: /usr/share/launchpad-buildd/slavebin/slave-prep ['slave-prep'] Forking launchpad-buildd slave process... Kernel version: 3.2.0-39-powerpc64-smp #62-Ubuntu SMP Thu Feb 28 00:22:58 UTC 2013 ppc64 Buildd toolchain package versions: launchpad-buildd_114-0~53~0.IS.08.04 python-lpbuildd_114-0~53~0.IS.08.04 bzr_2.5.1-0ubuntu2. Syncing the system clock with the buildd NTP service... 23 Apr 19:46:50 ntpdate[7312]: adjust time server 10.211.37.1 offset 0.000026 sec RUN: /usr/share/launchpad-buildd/slavebin/unpack-chroot ['unpack-chroot', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd', '/home/buildd/filecache-default/9b64857fb5ad744c2f7484cc1aadabf3e0ae69e5'] Unpacking chroot for build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd RUN: /usr/share/launchpad-buildd/slavebin/mount-chroot ['mount-chroot', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd'] Mounting chroot for build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd RUN: /usr/share/launchpad-buildd/slavebin/override-sources-list ['override-sources-list', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd', 'deb http://ftpmaster.internal/ubuntu raring main restricted universe multiverse'] Overriding sources.list in build-2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd RUN: /usr/share/launchpad-buildd/slavebin/update-debian-chroot ['update-debian-chroot', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd', 'powerpc'] Updating debian chroot for build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd Get:1 http://ftpmaster.internal raring Release.gpg [933 B] Get:2 http://ftpmaster.internal raring Release [40.8 kB] Get:3 http://ftpmaster.internal raring/main powerpc Packages [1152 kB] Get:4 http://ftpmaster.internal raring/restricted powerpc Packages [14 B] Get:5 http://ftpmaster.internal raring/universe powerpc Packages [5289 kB] Get:6 http://ftpmaster.internal raring/multiverse powerpc Packages [113 kB] Get:7 http://ftpmaster.internal raring/main Translation-en [673 kB] Get:8 http://ftpmaster.internal raring/multiverse Translation-en [98.4 kB] Get:9 http://ftpmaster.internal raring/restricted Translation-en [2767 B] Get:10 http://ftpmaster.internal raring/universe Translation-en [3736 kB] Fetched 11.1 MB in 11s (956 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... The following packages will be upgraded: libudev1 1 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 43.7 kB of archives. After this operation, 0 B of additional disk space will be used. WARNING: The following packages cannot be authenticated! libudev1 Authentication warning overridden. Get:1 http://ftpmaster.internal/ubuntu/ raring/main libudev1 powerpc 198-0ubuntu11 [43.7 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 43.7 kB in 0s (67.5 kB/s) (Reading database ... 12042 files and directories currently installed.) Preparing to replace libudev1:powerpc 198-0ubuntu10 (using .../libudev1_198-0ubuntu11_powerpc.deb) ... Unpacking replacement libudev1:powerpc ... Setting up libudev1:powerpc (198-0ubuntu11) ... Processing triggers for libc-bin ... ldconfig deferred processing now taking place RUN: /usr/share/launchpad-buildd/slavebin/sbuild-package ['sbuild-package', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd', 'powerpc', 'raring', '--nolog', '--batch', '--archive=ubuntu', '--dist=raring', '--purpose=PRIMARY', '--architecture=powerpc', '--comp=multiverse', 'gmap_2012-06-12-1ubuntu1.dsc'] Initiating build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd with 24 jobs across 24 processor cores. Kernel reported to sbuild: 3.2.0-39-powerpc64-smp #62-Ubuntu SMP Thu Feb 28 00:22:58 UTC 2013 ppc Automatic build of gmap_2012-06-12-1ubuntu1 on sagari by sbuild/powerpc 1.170.5 Build started at 20130423-1947 ****************************************************************************** gmap_2012-06-12-1ubuntu1.dsc exists in cwd ** Using build dependencies supplied by package: Build-Depends: debhelper (>= 8), autotools-dev Checking for already installed source dependencies... debhelper: missing autotools-dev: missing Checking for source dependency conflicts... /usr/bin/sudo /usr/bin/apt-get --purge $CHROOT_OPTIONS -q -y install debhelper autotools-dev Reading package lists... Building dependency tree... Reading state information... The following extra packages will be installed: bsdmainutils dh-apparmor file gettext gettext-base groff-base html2text intltool-debian libasprintf-dev libasprintf0c2 libcroco3 libgettextpo-dev libgettextpo0 libmagic1 libpipeline1 libunistring0 libxml2 man-db po-debconf Suggested packages: wamerican wordlist whois vacation dh-make gettext-doc groff less www-browser libmail-box-perl Recommended packages: curl wget lynx-cur xml-core libmail-sendmail-perl The following NEW packages will be installed: autotools-dev bsdmainutils debhelper dh-apparmor file gettext gettext-base groff-base html2text intltool-debian libasprintf-dev libasprintf0c2 libcroco3 libgettextpo-dev libgettextpo0 libmagic1 libpipeline1 libunistring0 libxml2 man-db po-debconf 0 upgraded, 21 newly installed, 0 to remove and 0 not upgraded. Need to get 5209 kB of archives. After this operation, 18.3 MB of additional disk space will be used. WARNING: The following packages cannot be authenticated! libmagic1 libasprintf0c2 libpipeline1 libxml2 groff-base bsdmainutils man-db libcroco3 libunistring0 libgettextpo0 file gettext-base autotools-dev html2text libasprintf-dev libgettextpo-dev gettext intltool-debian po-debconf dh-apparmor debhelper Authentication warning overridden. Get:1 http://ftpmaster.internal/ubuntu/ raring/main libmagic1 powerpc 5.11-2ubuntu4 [170 kB] Get:2 http://ftpmaster.internal/ubuntu/ raring/main libasprintf0c2 powerpc 0.18.1.1-10ubuntu3 [6984 B] Get:3 http://ftpmaster.internal/ubuntu/ raring/main libpipeline1 powerpc 1.2.2-2 [26.1 kB] Get:4 http://ftpmaster.internal/ubuntu/ raring/main libxml2 powerpc 2.9.0+dfsg1-4ubuntu4 [644 kB] Get:5 http://ftpmaster.internal/ubuntu/ raring/main groff-base powerpc 1.22.1-3 [696 kB] Get:6 http://ftpmaster.internal/ubuntu/ raring/main bsdmainutils powerpc 9.0.4ubuntu3 [202 kB] Get:7 http://ftpmaster.internal/ubuntu/ raring/main man-db powerpc 2.6.3-3 [613 kB] Get:8 http://ftpmaster.internal/ubuntu/ raring/main libcroco3 powerpc 0.6.8-1 [70.1 kB] Get:9 http://ftpmaster.internal/ubuntu/ raring/main libunistring0 powerpc 0.9.3-5build1 [412 kB] Get:10 http://ftpmaster.internal/ubuntu/ raring/main libgettextpo0 powerpc 0.18.1.1-10ubuntu3 [115 kB] Get:11 http://ftpmaster.internal/ubuntu/ raring/main file powerpc 5.11-2ubuntu4 [18.2 kB] Get:12 http://ftpmaster.internal/ubuntu/ raring/main gettext-base powerpc 0.18.1.1-10ubuntu3 [64.3 kB] Get:13 http://ftpmaster.internal/ubuntu/ raring/main autotools-dev all 20120608.1 [42.9 kB] Get:14 http://ftpmaster.internal/ubuntu/ raring/main html2text powerpc 1.3.2a-15ubuntu3 [93.6 kB] Get:15 http://ftpmaster.internal/ubuntu/ raring/main libasprintf-dev powerpc 0.18.1.1-10ubuntu3 [4614 B] Get:16 http://ftpmaster.internal/ubuntu/ raring/main libgettextpo-dev powerpc 0.18.1.1-10ubuntu3 [158 kB] Get:17 http://ftpmaster.internal/ubuntu/ raring/main gettext powerpc 0.18.1.1-10ubuntu3 [992 kB] Get:18 http://ftpmaster.internal/ubuntu/ raring/main intltool-debian all 0.35.0+20060710.1 [31.6 kB] Get:19 http://ftpmaster.internal/ubuntu/ raring/main po-debconf all 1.0.16+nmu2ubuntu1 [210 kB] Get:20 http://ftpmaster.internal/ubuntu/ raring/main dh-apparmor all 2.8.0-0ubuntu11 [8392 B] Get:21 http://ftpmaster.internal/ubuntu/ raring/main debhelper all 9.20120909ubuntu1 [631 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 5209 kB in 6s (812 kB/s) Selecting previously unselected package libmagic1:powerpc. (Reading database ... 12042 files and directories currently installed.) Unpacking libmagic1:powerpc (from .../libmagic1_5.11-2ubuntu4_powerpc.deb) ... Selecting previously unselected package libasprintf0c2:powerpc. Unpacking libasprintf0c2:powerpc (from .../libasprintf0c2_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package libpipeline1:powerpc. Unpacking libpipeline1:powerpc (from .../libpipeline1_1.2.2-2_powerpc.deb) ... Selecting previously unselected package libxml2:powerpc. Unpacking libxml2:powerpc (from .../libxml2_2.9.0+dfsg1-4ubuntu4_powerpc.deb) ... Selecting previously unselected package groff-base. Unpacking groff-base (from .../groff-base_1.22.1-3_powerpc.deb) ... Selecting previously unselected package bsdmainutils. Unpacking bsdmainutils (from .../bsdmainutils_9.0.4ubuntu3_powerpc.deb) ... Selecting previously unselected package man-db. Unpacking man-db (from .../man-db_2.6.3-3_powerpc.deb) ... Selecting previously unselected package libcroco3:powerpc. Unpacking libcroco3:powerpc (from .../libcroco3_0.6.8-1_powerpc.deb) ... Selecting previously unselected package libunistring0:powerpc. Unpacking libunistring0:powerpc (from .../libunistring0_0.9.3-5build1_powerpc.deb) ... Selecting previously unselected package libgettextpo0:powerpc. Unpacking libgettextpo0:powerpc (from .../libgettextpo0_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package file. Unpacking file (from .../file_5.11-2ubuntu4_powerpc.deb) ... Selecting previously unselected package gettext-base. Unpacking gettext-base (from .../gettext-base_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package autotools-dev. Unpacking autotools-dev (from .../autotools-dev_20120608.1_all.deb) ... Selecting previously unselected package html2text. Unpacking html2text (from .../html2text_1.3.2a-15ubuntu3_powerpc.deb) ... Selecting previously unselected package libasprintf-dev:powerpc. Unpacking libasprintf-dev:powerpc (from .../libasprintf-dev_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package libgettextpo-dev:powerpc. Unpacking libgettextpo-dev:powerpc (from .../libgettextpo-dev_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package gettext. Unpacking gettext (from .../gettext_0.18.1.1-10ubuntu3_powerpc.deb) ... Selecting previously unselected package intltool-debian. Unpacking intltool-debian (from .../intltool-debian_0.35.0+20060710.1_all.deb) ... Selecting previously unselected package po-debconf. Unpacking po-debconf (from .../po-debconf_1.0.16+nmu2ubuntu1_all.deb) ... Selecting previously unselected package dh-apparmor. Unpacking dh-apparmor (from .../dh-apparmor_2.8.0-0ubuntu11_all.deb) ... Selecting previously unselected package debhelper. Unpacking debhelper (from .../debhelper_9.20120909ubuntu1_all.deb) ... Setting up libmagic1:powerpc (5.11-2ubuntu4) ... Setting up libasprintf0c2:powerpc (0.18.1.1-10ubuntu3) ... Setting up libpipeline1:powerpc (1.2.2-2) ... Setting up libxml2:powerpc (2.9.0+dfsg1-4ubuntu4) ... Setting up groff-base (1.22.1-3) ... Setting up bsdmainutils (9.0.4ubuntu3) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up man-db (2.6.3-3) ... Building database of manual pages ... Setting up libcroco3:powerpc (0.6.8-1) ... Setting up libunistring0:powerpc (0.9.3-5build1) ... Setting up libgettextpo0:powerpc (0.18.1.1-10ubuntu3) ... Setting up file (5.11-2ubuntu4) ... Setting up gettext-base (0.18.1.1-10ubuntu3) ... Setting up autotools-dev (20120608.1) ... Setting up html2text (1.3.2a-15ubuntu3) ... Setting up libasprintf-dev:powerpc (0.18.1.1-10ubuntu3) ... Setting up libgettextpo-dev:powerpc (0.18.1.1-10ubuntu3) ... Setting up gettext (0.18.1.1-10ubuntu3) ... Setting up intltool-debian (0.35.0+20060710.1) ... Setting up po-debconf (1.0.16+nmu2ubuntu1) ... Setting up dh-apparmor (2.8.0-0ubuntu11) ... Setting up debhelper (9.20120909ubuntu1) ... Processing triggers for libc-bin ... ldconfig deferred processing now taking place Checking correctness of source dependencies... Toolchain package versions: libc6-dev_2.17-0ubuntu5 make_3.81-8.2ubuntu2 dpkg-dev_1.16.10ubuntu1 gcc-4.7_4.7.3-1ubuntu1 g++-4.7_4.7.3-1ubuntu1 binutils_2.23.2-2ubuntu1 libstdc++6-4.7-dev_4.7.3-1ubuntu1 libstdc++6_4.7.3-1ubuntu1 ------------------------------------------------------------------------------ dpkg-source: warning: -sn is not a valid option for Dpkg::Source::Package::V3::quilt gpgv: Signature made Tue Jul 3 17:08:05 2012 UTC using DSA key ID 60E80B5B gpgv: Can't check signature: public key not found dpkg-source: warning: failed to verify signature on ./gmap_2012-06-12-1ubuntu1.dsc dpkg-source: info: extracting gmap in gmap-2012-06-12 dpkg-source: info: unpacking gmap_2012-06-12.orig.tar.gz dpkg-source: info: unpacking gmap_2012-06-12-1ubuntu1.debian.tar.gz dpkg-source: info: applying install-data-local dpkg-source: info: applying fix-Indexdb_write_gammaptrs-decl.patch dpkg-buildpackage: source package gmap dpkg-buildpackage: source version 2012-06-12-1ubuntu1 dpkg-source --before-build gmap-2012-06-12 dpkg-buildpackage: host architecture powerpc /usr/bin/fakeroot debian/rules clean dh clean --with autotools_dev dh_testdir dh_auto_clean dh_autotools-dev_restoreconfig dh_clean debian/rules build-arch dh build-arch --with autotools_dev dh_testdir -a dh_autotools-dev_updateconfig -a debian/rules override_dh_auto_configure make[1]: Entering directory `/build/buildd/gmap-2012-06-12' dh_auto_configure -- --with-gmapdb=/var/cache/gmap configure: WARNING: unrecognized options: --disable-maintainer-mode checking package version... 2012-06-12 checking CONFIG_SITE... ./config.site loading script ./config.site checking CFLAGS... not set by user so using default -O3 checking build system type... powerpc-unknown-linux-gnu checking host system type... powerpc-unknown-linux-gnu checking target system type... powerpc-unknown-linux-gnu checking for gcc... gcc checking for C compiler default output file name... a.out checking whether the C compiler works... yes checking whether we are cross compiling... no checking for suffix of executables... checking for suffix of object files... o checking whether we are using the GNU C compiler... yes checking whether gcc accepts -g... yes checking for gcc option to accept ISO C89... none needed checking for special C compiler options needed for large files... no checking for _FILE_OFFSET_BITS value needed for large files... 64 checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for a thread-safe mkdir -p... /bin/mkdir -p checking for gawk... no checking for mawk... mawk checking whether make sets $(MAKE)... yes checking for style of include used by make... GNU checking dependency style of gcc... none checking bindir... /usr/bin checking for a working version of perl... /usr/bin/perl checking for gcc... (cached) gcc checking whether we are using the GNU C compiler... (cached) yes checking whether gcc accepts -g... (cached) yes checking for gcc option to accept ISO C89... (cached) none needed checking whether gcc and cc understand -c and -o together... yes checking for a sed that does not truncate output... /bin/sed checking for grep that handles long lines and -e... /bin/grep checking for egrep... /bin/grep -E checking for fgrep... /bin/grep -F checking for ld used by gcc... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B checking the name lister (/usr/bin/nm -B) interface... BSD nm checking whether ln -s works... yes checking the maximum length of command line arguments... 805306365 checking whether the shell understands some XSI constructs... yes checking whether the shell understands "+="... yes checking for /usr/bin/ld option to reload object files... -r checking for objdump... objdump checking how to recognize dependent libraries... pass_all checking for ar... ar checking for strip... strip checking for ranlib... ranlib checking command to parse /usr/bin/nm -B output from gcc object... ok checking how to run the C preprocessor... gcc -E checking for ANSI C header files... yes checking for sys/types.h... yes checking for sys/stat.h... yes checking for stdlib.h... yes checking for string.h... yes checking for memory.h... yes checking for strings.h... yes checking for inttypes.h... yes checking for stdint.h... yes checking for unistd.h... yes checking for dlfcn.h... yes checking for objdir... .libs checking if gcc supports -fno-rtti -fno-exceptions... no checking for gcc option to produce PIC... -fPIC -DPIC checking if gcc PIC flag -fPIC -DPIC works... yes checking if gcc static flag -static works... yes checking if gcc supports -c -o file.o... yes checking if gcc supports -c -o file.o... (cached) yes checking whether the gcc linker (/usr/bin/ld) supports shared libraries... yes checking whether -lc should be explicitly linked in... no checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes checking if libtool supports shared libraries... yes checking whether to build shared libraries... yes checking whether to build static libraries... yes checking for rint in -lm... yes checking for pthreads feature... not specified so enabled by default checking for the pthreads library -lpthreads... no checking whether pthreads work without any flags... no checking whether pthreads work with -Kthread... no checking whether pthreads work with -kthread... no checking for the pthreads library -llthread... no checking whether pthreads work with -pthread... yes checking for joinable pthread attribute... PTHREAD_CREATE_JOINABLE checking if more special flags are required for pthreads... no checking for cc_r... gcc checking for ANSI C header files... (cached) yes checking for dirent.h that defines DIR... yes checking for library containing opendir... none required checking fcntl.h usability... yes checking fcntl.h presence... yes checking for fcntl.h... yes checking limits.h usability... yes checking limits.h presence... yes checking for limits.h... yes checking stddef.h usability... yes checking stddef.h presence... yes checking for stddef.h... yes checking for stdlib.h... (cached) yes checking for string.h... (cached) yes checking for strings.h... (cached) yes checking for unistd.h... (cached) yes checking for sys/types.h... (cached) yes checking whether byte ordering is bigendian... yes checking for an ANSI C-conforming const... yes checking for working volatile... yes checking for size_t... yes checking for off_t... yes checking for caddr_t... yes checking size of unsigned long... 4 checking size of unsigned long long... 8 checking for _LARGEFILE_SOURCE value needed for large files... no checking whether mmap is enabled... not specified so enabled by default checking for working mmap with MAP_FIXED... yes checking for working mmap with MAP_VARIABLE... no checking for MAP_FILE in mmap... yes checking for MAP_VARIABLE in mmap... no checking for MAP_SHARED in mmap... yes checking for MAP_PRIVATE in mmap... yes checking for MAP_FAILED in mmap... yes checking for MADV_DONTNEED in madvise... yes checking for MADV_WILLNEED in madvise... yes checking for MADV_RANDOM in madvise... yes checking for ceil... yes checking for floor... yes checking for index... yes checking for log... yes checking for madvise... yes checking for memcpy... yes checking for memmove... yes checking for memset... yes checking for munmap... yes checking for pow... yes checking for rint... yes checking for stat64... yes checking for strtoul... yes checking for sysconf... yes checking for sysctl... yes checking for sigaction... yes checking for struct stat64... no checking for pagesize via sysconf... yes checking for pagesize via sysctl... no checking whether fopen accepts "b" mode... yes checking whether fopen accepts "t" mode... yes checking for __builtin_popcount... yes checking for __builtin_clz... yes checking for __builtin_ctz... yes checking for bsr instruction in assembly... yes checking for popcnt feature... not specified so enabled by default checking whether -mpopcnt compiler flag works... no checking gmapdb... /var/cache/gmap checking MAX_READLENGTH... 250 checking for zlib support... enabled checking zlib.h usability... no checking zlib.h presence... no checking for zlib.h... no checking for gzopen in -lz... no checking for gzeof in -lz... no checking for gzgetc in -lz... no checking for gzgets in -lz... no checking for gzclose in -lz... no checking if zlib package is complete... no -- some components failed test checking for samtools library... disabled checking for goby library... disabled configure: creating ./config.status config.status: creating Makefile config.status: creating src/Makefile config.status: creating util/Makefile config.status: creating util/gmap_compress.pl config.status: creating util/gmap_uncompress.pl config.status: creating util/gmap_process.pl config.status: creating util/gmap_setup.pl config.status: creating util/gmap_build.pl config.status: creating util/gmap_reassemble.pl config.status: creating util/md_coords.pl config.status: creating util/fa_coords.pl config.status: creating util/psl_splicesites.pl config.status: creating util/psl_introns.pl config.status: creating util/psl_genes.pl config.status: creating util/gtf_splicesites.pl config.status: creating util/gtf_introns.pl config.status: creating util/gtf_genes.pl config.status: creating util/gff3_splicesites.pl config.status: creating util/gff3_introns.pl config.status: creating util/gff3_genes.pl config.status: creating util/dbsnp_iit.pl config.status: creating tests/Makefile config.status: creating tests/align.test config.status: creating tests/coords1.test config.status: creating tests/setup1.test config.status: creating tests/iit.test config.status: creating src/config.h config.status: executing depfiles commands config.status: executing libtool commands configure: WARNING: unrecognized options: --disable-maintainer-mode make[1]: Leaving directory `/build/buildd/gmap-2012-06-12' dh_auto_build -a make[1]: Entering directory `/build/buildd/gmap-2012-06-12' Making all in src make[2]: Entering directory `/build/buildd/gmap-2012-06-12/src' make all-am make[3]: Entering directory `/build/buildd/gmap-2012-06-12/src' gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-md5.o `test -f 'md5.c' || echo './'`md5.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-sequence.o `test -f 'sequence.c' || echo './'`sequence.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-reader.o `test -f 'reader.c' || echo './'`reader.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-gbuffer.o `test -f 'gbuffer.c' || echo './'`gbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-genome.o `test -f 'genome.c' || echo './'`genome.c genome.c: In function 'Genome_ntcounts': genome.c:10414:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'genomecomp_read_current': genome.c:339:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'fill_buffer': genome.c:9884:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_get_char': genome.c:10242:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple_alt': genome.c:10136:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple': genome.c:10040:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-genome-write.o `test -f 'genome-write.c' || echo './'`genome-write.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-indexdb_hr.o `test -f 'indexdb_hr.c' || echo './'`indexdb_hr.c indexdb_hr.c: In function 'positions_move_absolute': indexdb_hr.c:562:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb_hr.c: In function 'positions_read_multiple': indexdb_hr.c:578:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-oligo.o `test -f 'oligo.c' || echo './'`oligo.c oligo.c:869:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:870:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:871:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:872:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:873:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:874:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:875:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:876:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:877:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:878:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:879:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:880:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:881:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:882:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:883:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:884:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:885:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:886:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:887:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:888:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:889:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:890:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:891:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:892:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:893:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:894:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:895:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:896:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:897:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:898:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:899:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:900:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:901:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:902:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:903:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:904:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:905:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:906:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-block.o `test -f 'block.c' || echo './'`block.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-segmentpos.o `test -f 'segmentpos.c' || echo './'`segmentpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-chrnum.o `test -f 'chrnum.c' || echo './'`chrnum.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-chrsubset.o `test -f 'chrsubset.c' || echo './'`chrsubset.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-uinttable.o `test -f 'uinttable.c' || echo './'`uinttable.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-gregion.o `test -f 'gregion.c' || echo './'`gregion.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-match.o `test -f 'match.c' || echo './'`match.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-matchpool.o `test -f 'matchpool.c' || echo './'`matchpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-diagnostic.o `test -f 'diagnostic.c' || echo './'`diagnostic.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-stage1.o `test -f 'stage1.c' || echo './'`stage1.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-diag.o `test -f 'diag.c' || echo './'`diag.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-diagpool.o `test -f 'diagpool.c' || echo './'`diagpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-orderstat.o `test -f 'orderstat.c' || echo './'`orderstat.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-oligoindex.o `test -f 'oligoindex.c' || echo './'`oligoindex.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-oligoindex_hr.o `test -f 'oligoindex_hr.c' || echo './'`oligoindex_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-intron.o `test -f 'intron.c' || echo './'`intron.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-maxent.o `test -f 'maxent.c' || echo './'`maxent.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-maxent_hr.o `test -f 'maxent_hr.c' || echo './'`maxent_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-pair.o `test -f 'pair.c' || echo './'`pair.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-pairpool.o `test -f 'pairpool.c' || echo './'`pairpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-stage2.o `test -f 'stage2.c' || echo './'`stage2.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-smooth.o `test -f 'smooth.c' || echo './'`smooth.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-splicetrie_build.o `test -f 'splicetrie_build.c' || echo './'`splicetrie_build.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-splicetrie.o `test -f 'splicetrie.c' || echo './'`splicetrie.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-boyer-moore.o `test -f 'boyer-moore.c' || echo './'`boyer-moore.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-dynprog.o `test -f 'dynprog.c' || echo './'`dynprog.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-translation.o `test -f 'translation.c' || echo './'`translation.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-pbinom.o `test -f 'pbinom.c' || echo './'`pbinom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-changepoint.o `test -f 'changepoint.c' || echo './'`changepoint.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-stage3.o `test -f 'stage3.c' || echo './'`stage3.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-request.o `test -f 'request.c' || echo './'`request.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-result.o `test -f 'result.c' || echo './'`result.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-inbuffer.o `test -f 'inbuffer.c' || echo './'`inbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-outbuffer.o `test -f 'outbuffer.c' || echo './'`outbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-chimera.o `test -f 'chimera.c' || echo './'`chimera.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o gmap-gmap.o `test -f 'gmap.c' || echo './'`gmap.c gmap.c: In function 'print_program_version': gmap.c:539:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'unsigned int' [-Wformat] gmap.c:539:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] gmap.c:539:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'unsigned int' [-Wformat] gmap.c:539:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 6 has type 'unsigned int' [-Wformat] /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o gmap gmap-except.o gmap-assert.o gmap-mem.o gmap-intlist.o gmap-list.o gmap-littleendian.o gmap-bigendian.o gmap-interval.o gmap-uintlist.o gmap-stopwatch.o gmap-access.o gmap-iit-read.o gmap-md5.o gmap-sequence.o gmap-reader.o gmap-genomicpos.o gmap-compress.o gmap-cmet.o gmap-atoi.o gmap-gbuffer.o gmap-genome.o gmap-genome_hr.o gmap-genome-write.o gmap-indexdb.o gmap-indexdb_hr.o gmap-oligo.o gmap-block.o gmap-chrom.o gmap-segmentpos.o gmap-chrnum.o gmap-chrsubset.o gmap-uinttable.o gmap-gregion.o gmap-match.o gmap-matchpool.o gmap-diagnostic.o gmap-stage1.o gmap-diag.o gmap-diagpool.o gmap-orderstat.o gmap-oligoindex.o gmap-oligoindex_hr.o gmap-intron.o gmap-maxent.o gmap-maxent_hr.o gmap-pair.o gmap-pairpool.o gmap-stage2.o gmap-smooth.o gmap-splicetrie_build.o gmap-splicetrie.o gmap-boyer-moore.o gmap-dynprog.o gmap-translation.o gmap-pbinom.o gmap-changepoint.o gmap-stage3.o gmap-request.o gmap-result.o gmap-inbuffer.o gmap-outbuffer.o gmap-chimera.o gmap-datadir.o gmap-getopt.o gmap-getopt1.o gmap-gmap.o -lm libtool: link: gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o gmap gmap-except.o gmap-assert.o gmap-mem.o gmap-intlist.o gmap-list.o gmap-littleendian.o gmap-bigendian.o gmap-interval.o gmap-uintlist.o gmap-stopwatch.o gmap-access.o gmap-iit-read.o gmap-md5.o gmap-sequence.o gmap-reader.o gmap-genomicpos.o gmap-compress.o gmap-cmet.o gmap-atoi.o gmap-gbuffer.o gmap-genome.o gmap-genome_hr.o gmap-genome-write.o gmap-indexdb.o gmap-indexdb_hr.o gmap-oligo.o gmap-block.o gmap-chrom.o gmap-segmentpos.o gmap-chrnum.o gmap-chrsubset.o gmap-uinttable.o gmap-gregion.o gmap-match.o gmap-matchpool.o gmap-diagnostic.o gmap-stage1.o gmap-diag.o gmap-diagpool.o gmap-orderstat.o gmap-oligoindex.o gmap-oligoindex_hr.o gmap-intron.o gmap-maxent.o gmap-maxent_hr.o gmap-pair.o gmap-pairpool.o gmap-stage2.o gmap-smooth.o gmap-splicetrie_build.o gmap-splicetrie.o gmap-boyer-moore.o gmap-dynprog.o gmap-translation.o gmap-pbinom.o gmap-changepoint.o gmap-stage3.o gmap-request.o gmap-result.o gmap-inbuffer.o gmap-outbuffer.o gmap-chimera.o gmap-datadir.o gmap-getopt.o gmap-getopt1.o gmap-gmap.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-md5.o `test -f 'md5.c' || echo './'`md5.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-sequence.o `test -f 'sequence.c' || echo './'`sequence.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-genome.o `test -f 'genome.c' || echo './'`genome.c genome.c: In function 'Genome_ntcounts': genome.c:10414:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'genomecomp_read_current': genome.c:339:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'fill_buffer': genome.c:9884:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_get_char': genome.c:10242:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple_alt': genome.c:10136:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple': genome.c:10040:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-chrnum.o `test -f 'chrnum.c' || echo './'`chrnum.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-chrsubset.o `test -f 'chrsubset.c' || echo './'`chrsubset.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-parserange.o `test -f 'parserange.c' || echo './'`parserange.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o get_genome-get-genome.o `test -f 'get-genome.c' || echo './'`get-genome.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o get-genome get_genome-except.o get_genome-assert.o get_genome-mem.o get_genome-intlist.o get_genome-list.o get_genome-littleendian.o get_genome-bigendian.o get_genome-interval.o get_genome-uintlist.o get_genome-stopwatch.o get_genome-access.o get_genome-iit-read.o get_genome-md5.o get_genome-sequence.o get_genome-genome.o get_genome-genomicpos.o get_genome-chrom.o get_genome-chrnum.o get_genome-chrsubset.o get_genome-datadir.o get_genome-parserange.o get_genome-getopt.o get_genome-getopt1.o get_genome-get-genome.o -lm libtool: link: gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o get-genome get_genome-except.o get_genome-assert.o get_genome-mem.o get_genome-intlist.o get_genome-list.o get_genome-littleendian.o get_genome-bigendian.o get_genome-interval.o get_genome-uintlist.o get_genome-stopwatch.o get_genome-access.o get_genome-iit-read.o get_genome-md5.o get_genome-sequence.o get_genome-genome.o get_genome-genomicpos.o get_genome-chrom.o get_genome-chrnum.o get_genome-chrsubset.o get_genome-datadir.o get_genome-parserange.o get_genome-getopt.o get_genome-getopt1.o get_genome-get-genome.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-iit-write.o `test -f 'iit-write.c' || echo './'`iit-write.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-genome-write.o `test -f 'genome-write.c' || echo './'`genome-write.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-table.o `test -f 'table.c' || echo './'`table.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-tableint.o `test -f 'tableint.c' || echo './'`tableint.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-segmentpos.o `test -f 'segmentpos.c' || echo './'`segmentpos.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o gmapindex-gmapindex.o `test -f 'gmapindex.c' || echo './'`gmapindex.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -O3 -pthread -o gmapindex gmapindex-except.o gmapindex-assert.o gmapindex-mem.o gmapindex-intlist.o gmapindex-list.o gmapindex-littleendian.o gmapindex-bigendian.o gmapindex-interval.o gmapindex-uintlist.o gmapindex-stopwatch.o gmapindex-access.o gmapindex-iit-read.o gmapindex-iit-write.o gmapindex-genomicpos.o gmapindex-compress.o gmapindex-genome-write.o gmapindex-cmet.o gmapindex-atoi.o gmapindex-genome_hr.o gmapindex-indexdb.o gmapindex-table.o gmapindex-tableint.o gmapindex-chrom.o gmapindex-segmentpos.o gmapindex-gmapindex.o -lm libtool: link: gcc -pthread -O3 -pthread -o gmapindex gmapindex-except.o gmapindex-assert.o gmapindex-mem.o gmapindex-intlist.o gmapindex-list.o gmapindex-littleendian.o gmapindex-bigendian.o gmapindex-interval.o gmapindex-uintlist.o gmapindex-stopwatch.o gmapindex-access.o gmapindex-iit-read.o gmapindex-iit-write.o gmapindex-genomicpos.o gmapindex-compress.o gmapindex-genome-write.o gmapindex-cmet.o gmapindex-atoi.o gmapindex-genome_hr.o gmapindex-indexdb.o gmapindex-table.o gmapindex-tableint.o gmapindex-chrom.o gmapindex-segmentpos.o gmapindex-gmapindex.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-iit-write.o `test -f 'iit-write.c' || echo './'`iit-write.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-tableint.o `test -f 'tableint.c' || echo './'`tableint.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-table.o `test -f 'table.c' || echo './'`table.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_store-iit_store.o `test -f 'iit_store.c' || echo './'`iit_store.c iit_store.c: In function 'parse_fasta': iit_store.c:577:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'UINT8' [-Wformat] iit_store.c:578:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'UINT8' [-Wformat] iit_store.c: In function 'parse_fieldlist': iit_store.c:432:10: warning: ignoring return value of 'fgets', declared with attribute warn_unused_result [-Wunused-result] iit_store.c: In function 'parse_fasta': iit_store.c:467:10: warning: ignoring return value of 'fgets', declared with attribute warn_unused_result [-Wunused-result] iit_store.c:470:10: warning: ignoring return value of 'fgets', declared with attribute warn_unused_result [-Wunused-result] /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -O3 -pthread -o iit_store iit_store-except.o iit_store-assert.o iit_store-mem.o iit_store-intlist.o iit_store-list.o iit_store-littleendian.o iit_store-bigendian.o iit_store-interval.o iit_store-uintlist.o iit_store-stopwatch.o iit_store-access.o iit_store-iit-write.o iit_store-tableint.o iit_store-table.o iit_store-chrom.o iit_store-getopt.o iit_store-getopt1.o iit_store-iit_store.o -lm libtool: link: gcc -pthread -O3 -pthread -o iit_store iit_store-except.o iit_store-assert.o iit_store-mem.o iit_store-intlist.o iit_store-list.o iit_store-littleendian.o iit_store-bigendian.o iit_store-interval.o iit_store-uintlist.o iit_store-stopwatch.o iit_store-access.o iit_store-iit-write.o iit_store-tableint.o iit_store-table.o iit_store-chrom.o iit_store-getopt.o iit_store-getopt1.o iit_store-iit_store.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-parserange.o `test -f 'parserange.c' || echo './'`parserange.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_get-iit_get.o `test -f 'iit_get.c' || echo './'`iit_get.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -O3 -pthread -o iit_get iit_get-except.o iit_get-assert.o iit_get-mem.o iit_get-intlist.o iit_get-list.o iit_get-littleendian.o iit_get-bigendian.o iit_get-interval.o iit_get-uintlist.o iit_get-stopwatch.o iit_get-access.o iit_get-iit-read.o iit_get-parserange.o iit_get-getopt.o iit_get-getopt1.o iit_get-iit_get.o -lm libtool: link: gcc -pthread -O3 -pthread -o iit_get iit_get-except.o iit_get-assert.o iit_get-mem.o iit_get-intlist.o iit_get-list.o iit_get-littleendian.o iit_get-bigendian.o iit_get-interval.o iit_get-uintlist.o iit_get-stopwatch.o iit_get-access.o iit_get-iit-read.o iit_get-parserange.o iit_get-getopt.o iit_get-getopt1.o iit_get-iit_get.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -O3 -c -o iit_dump-iit_dump.o `test -f 'iit_dump.c' || echo './'`iit_dump.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -O3 -pthread -o iit_dump iit_dump-except.o iit_dump-assert.o iit_dump-mem.o iit_dump-littleendian.o iit_dump-bigendian.o iit_dump-intlist.o iit_dump-list.o iit_dump-interval.o iit_dump-uintlist.o iit_dump-stopwatch.o iit_dump-access.o iit_dump-iit-read.o iit_dump-getopt.o iit_dump-getopt1.o iit_dump-iit_dump.o -lm libtool: link: gcc -pthread -O3 -pthread -o iit_dump iit_dump-except.o iit_dump-assert.o iit_dump-mem.o iit_dump-littleendian.o iit_dump-bigendian.o iit_dump-intlist.o iit_dump-list.o iit_dump-interval.o iit_dump-uintlist.o iit_dump-stopwatch.o iit_dump-access.o iit_dump-iit-read.o iit_dump-getopt.o iit_dump-getopt1.o iit_dump-iit_dump.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-md5.o `test -f 'md5.c' || echo './'`md5.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-sequence.o `test -f 'sequence.c' || echo './'`sequence.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-reader.o `test -f 'reader.c' || echo './'`reader.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-genome.o `test -f 'genome.c' || echo './'`genome.c genome.c: In function 'Genome_ntcounts': genome.c:10414:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'genomecomp_read_current': genome.c:339:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'fill_buffer': genome.c:9884:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_get_char': genome.c:10242:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple_alt': genome.c:10136:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple': genome.c:10040:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-indexdb_hr.o `test -f 'indexdb_hr.c' || echo './'`indexdb_hr.c indexdb_hr.c: In function 'positions_move_absolute': indexdb_hr.c:562:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb_hr.c: In function 'positions_read_multiple': indexdb_hr.c:578:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-oligo.o `test -f 'oligo.c' || echo './'`oligo.c oligo.c:869:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:870:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:871:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:872:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:873:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:874:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:875:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:876:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:877:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:878:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:879:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:880:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:881:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:882:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:883:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:884:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:885:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:886:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:887:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:888:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:889:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:890:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:891:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:892:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:893:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:894:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:895:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:896:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:897:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:898:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:899:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:900:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:901:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:902:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:903:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:904:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:905:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:906:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-segmentpos.o `test -f 'segmentpos.c' || echo './'`segmentpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-chrnum.o `test -f 'chrnum.c' || echo './'`chrnum.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-maxent_hr.o `test -f 'maxent_hr.c' || echo './'`maxent_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-samprint.o `test -f 'samprint.c' || echo './'`samprint.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-mapq.o `test -f 'mapq.c' || echo './'`mapq.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-shortread.o `test -f 'shortread.c' || echo './'`shortread.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-substring.o `test -f 'substring.c' || echo './'`substring.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-stage3hr.o `test -f 'stage3hr.c' || echo './'`stage3hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-goby.o `test -f 'goby.c' || echo './'`goby.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-spanningelt.o `test -f 'spanningelt.c' || echo './'`spanningelt.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-maxent.o `test -f 'maxent.c' || echo './'`maxent.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-pair.o `test -f 'pair.c' || echo './'`pair.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-pairpool.o `test -f 'pairpool.c' || echo './'`pairpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-diag.o `test -f 'diag.c' || echo './'`diag.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-diagpool.o `test -f 'diagpool.c' || echo './'`diagpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-orderstat.o `test -f 'orderstat.c' || echo './'`orderstat.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-oligoindex.o `test -f 'oligoindex.c' || echo './'`oligoindex.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-oligoindex_hr.o `test -f 'oligoindex_hr.c' || echo './'`oligoindex_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-stage2.o `test -f 'stage2.c' || echo './'`stage2.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-intron.o `test -f 'intron.c' || echo './'`intron.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-boyer-moore.o `test -f 'boyer-moore.c' || echo './'`boyer-moore.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-changepoint.o `test -f 'changepoint.c' || echo './'`changepoint.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-pbinom.o `test -f 'pbinom.c' || echo './'`pbinom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-dynprog.o `test -f 'dynprog.c' || echo './'`dynprog.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-gbuffer.o `test -f 'gbuffer.c' || echo './'`gbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-translation.o `test -f 'translation.c' || echo './'`translation.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-smooth.o `test -f 'smooth.c' || echo './'`smooth.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-chimera.o `test -f 'chimera.c' || echo './'`chimera.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-stage3.o `test -f 'stage3.c' || echo './'`stage3.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-splicetrie_build.o `test -f 'splicetrie_build.c' || echo './'`splicetrie_build.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-splicetrie.o `test -f 'splicetrie.c' || echo './'`splicetrie.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-stage1hr.o `test -f 'stage1hr.c' || echo './'`stage1hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-request.o `test -f 'request.c' || echo './'`request.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-resulthr.o `test -f 'resulthr.c' || echo './'`resulthr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-inbuffer.o `test -f 'inbuffer.c' || echo './'`inbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-outbuffer.o `test -f 'outbuffer.c' || echo './'`outbuffer.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o gsnap-gsnap.o `test -f 'gsnap.c' || echo './'`gsnap.c gsnap.c: In function 'print_program_version': gsnap.c:535:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'unsigned int' [-Wformat] gsnap.c:535:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] gsnap.c:535:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'unsigned int' [-Wformat] gsnap.c:535:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 6 has type 'unsigned int' [-Wformat] /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -pthread -o gsnap gsnap-except.o gsnap-assert.o gsnap-mem.o gsnap-intlist.o gsnap-list.o gsnap-littleendian.o gsnap-bigendian.o gsnap-interval.o gsnap-uintlist.o gsnap-stopwatch.o gsnap-access.o gsnap-iit-read.o gsnap-md5.o gsnap-sequence.o gsnap-reader.o gsnap-genomicpos.o gsnap-compress.o gsnap-cmet.o gsnap-atoi.o gsnap-genome.o gsnap-genome_hr.o gsnap-indexdb.o gsnap-indexdb_hr.o gsnap-oligo.o gsnap-chrom.o gsnap-segmentpos.o gsnap-chrnum.o gsnap-maxent_hr.o gsnap-samprint.o gsnap-mapq.o gsnap-shortread.o gsnap-substring.o gsnap-stage3hr.o gsnap-goby.o gsnap-spanningelt.o gsnap-maxent.o gsnap-pair.o gsnap-pairpool.o gsnap-diag.o gsnap-diagpool.o gsnap-orderstat.o gsnap-oligoindex.o gsnap-oligoindex_hr.o gsnap-stage2.o gsnap-intron.o gsnap-boyer-moore.o gsnap-changepoint.o gsnap-pbinom.o gsnap-dynprog.o gsnap-gbuffer.o gsnap-translation.o gsnap-smooth.o gsnap-chimera.o gsnap-stage3.o gsnap-splicetrie_build.o gsnap-splicetrie.o gsnap-stage1hr.o gsnap-request.o gsnap-resulthr.o gsnap-inbuffer.o gsnap-outbuffer.o gsnap-datadir.o gsnap-getopt.o gsnap-getopt1.o gsnap-gsnap.o -lm libtool: link: gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -pthread -o gsnap gsnap-except.o gsnap-assert.o gsnap-mem.o gsnap-intlist.o gsnap-list.o gsnap-littleendian.o gsnap-bigendian.o gsnap-interval.o gsnap-uintlist.o gsnap-stopwatch.o gsnap-access.o gsnap-iit-read.o gsnap-md5.o gsnap-sequence.o gsnap-reader.o gsnap-genomicpos.o gsnap-compress.o gsnap-cmet.o gsnap-atoi.o gsnap-genome.o gsnap-genome_hr.o gsnap-indexdb.o gsnap-indexdb_hr.o gsnap-oligo.o gsnap-chrom.o gsnap-segmentpos.o gsnap-chrnum.o gsnap-maxent_hr.o gsnap-samprint.o gsnap-mapq.o gsnap-shortread.o gsnap-substring.o gsnap-stage3hr.o gsnap-goby.o gsnap-spanningelt.o gsnap-maxent.o gsnap-pair.o gsnap-pairpool.o gsnap-diag.o gsnap-diagpool.o gsnap-orderstat.o gsnap-oligoindex.o gsnap-oligoindex_hr.o gsnap-stage2.o gsnap-intron.o gsnap-boyer-moore.o gsnap-changepoint.o gsnap-pbinom.o gsnap-dynprog.o gsnap-gbuffer.o gsnap-translation.o gsnap-smooth.o gsnap-chimera.o gsnap-stage3.o gsnap-splicetrie_build.o gsnap-splicetrie.o gsnap-stage1hr.o gsnap-request.o gsnap-resulthr.o gsnap-inbuffer.o gsnap-outbuffer.o gsnap-datadir.o gsnap-getopt.o gsnap-getopt1.o gsnap-gsnap.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-md5.o `test -f 'md5.c' || echo './'`md5.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-sequence.o `test -f 'sequence.c' || echo './'`sequence.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-reader.o `test -f 'reader.c' || echo './'`reader.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-genome.o `test -f 'genome.c' || echo './'`genome.c genome.c: In function 'Genome_ntcounts': genome.c:10414:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'genomecomp_read_current': genome.c:339:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'fill_buffer': genome.c:9884:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_get_char': genome.c:10242:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple_alt': genome.c:10136:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple': genome.c:10040:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-indexdb_hr.o `test -f 'indexdb_hr.c' || echo './'`indexdb_hr.c indexdb_hr.c: In function 'positions_move_absolute': indexdb_hr.c:562:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb_hr.c: In function 'positions_read_multiple': indexdb_hr.c:578:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-oligo.o `test -f 'oligo.c' || echo './'`oligo.c oligo.c:869:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:870:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:871:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:872:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:873:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:874:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:875:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:876:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:877:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:878:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:879:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:880:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:881:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:882:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:883:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:884:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:885:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:886:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:887:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:888:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:889:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:890:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:891:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:892:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:893:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:894:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:895:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:896:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:897:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:898:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:899:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:900:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:901:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:902:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:903:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:904:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:905:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] oligo.c:906:4: warning: this decimal constant is unsigned only in ISO C90 [enabled by default] gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-segmentpos.o `test -f 'segmentpos.c' || echo './'`segmentpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-chrnum.o `test -f 'chrnum.c' || echo './'`chrnum.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-maxent_hr.o `test -f 'maxent_hr.c' || echo './'`maxent_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-mapq.o `test -f 'mapq.c' || echo './'`mapq.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-shortread.o `test -f 'shortread.c' || echo './'`shortread.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-substring.o `test -f 'substring.c' || echo './'`substring.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-stage3hr.o `test -f 'stage3hr.c' || echo './'`stage3hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-spanningelt.o `test -f 'spanningelt.c' || echo './'`spanningelt.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-maxent.o `test -f 'maxent.c' || echo './'`maxent.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-pair.o `test -f 'pair.c' || echo './'`pair.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-pairpool.o `test -f 'pairpool.c' || echo './'`pairpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-diag.o `test -f 'diag.c' || echo './'`diag.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-diagpool.o `test -f 'diagpool.c' || echo './'`diagpool.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-orderstat.o `test -f 'orderstat.c' || echo './'`orderstat.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-oligoindex.o `test -f 'oligoindex.c' || echo './'`oligoindex.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-oligoindex_hr.o `test -f 'oligoindex_hr.c' || echo './'`oligoindex_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-stage2.o `test -f 'stage2.c' || echo './'`stage2.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-intron.o `test -f 'intron.c' || echo './'`intron.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-boyer-moore.o `test -f 'boyer-moore.c' || echo './'`boyer-moore.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-changepoint.o `test -f 'changepoint.c' || echo './'`changepoint.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-pbinom.o `test -f 'pbinom.c' || echo './'`pbinom.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-dynprog.o `test -f 'dynprog.c' || echo './'`dynprog.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-translation.o `test -f 'translation.c' || echo './'`translation.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-smooth.o `test -f 'smooth.c' || echo './'`smooth.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-chimera.o `test -f 'chimera.c' || echo './'`chimera.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-stage3.o `test -f 'stage3.c' || echo './'`stage3.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-splicetrie_build.o `test -f 'splicetrie_build.c' || echo './'`splicetrie_build.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-splicetrie.o `test -f 'splicetrie.c' || echo './'`splicetrie.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-stage1hr.o `test -f 'stage1hr.c' || echo './'`stage1hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-resulthr.o `test -f 'resulthr.c' || echo './'`resulthr.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -c -o uniqscan-uniqscan.o `test -f 'uniqscan.c' || echo './'`uniqscan.c uniqscan.c: In function 'print_program_version': uniqscan.c:352:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'unsigned int' [-Wformat] uniqscan.c:352:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] uniqscan.c:352:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'unsigned int' [-Wformat] uniqscan.c:352:4: warning: format '%lu' expects argument of type 'long unsigned int', but argument 6 has type 'unsigned int' [-Wformat] /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -pthread -o uniqscan uniqscan-except.o uniqscan-assert.o uniqscan-mem.o uniqscan-intlist.o uniqscan-list.o uniqscan-littleendian.o uniqscan-bigendian.o uniqscan-interval.o uniqscan-uintlist.o uniqscan-stopwatch.o uniqscan-access.o uniqscan-iit-read.o uniqscan-md5.o uniqscan-sequence.o uniqscan-reader.o uniqscan-genomicpos.o uniqscan-compress.o uniqscan-cmet.o uniqscan-atoi.o uniqscan-genome.o uniqscan-genome_hr.o uniqscan-indexdb.o uniqscan-indexdb_hr.o uniqscan-oligo.o uniqscan-chrom.o uniqscan-segmentpos.o uniqscan-chrnum.o uniqscan-maxent_hr.o uniqscan-mapq.o uniqscan-shortread.o uniqscan-substring.o uniqscan-stage3hr.o uniqscan-spanningelt.o uniqscan-maxent.o uniqscan-pair.o uniqscan-pairpool.o uniqscan-diag.o uniqscan-diagpool.o uniqscan-orderstat.o uniqscan-oligoindex.o uniqscan-oligoindex_hr.o uniqscan-stage2.o uniqscan-intron.o uniqscan-boyer-moore.o uniqscan-changepoint.o uniqscan-pbinom.o uniqscan-dynprog.o uniqscan-translation.o uniqscan-smooth.o uniqscan-chimera.o uniqscan-stage3.o uniqscan-splicetrie_build.o uniqscan-splicetrie.o uniqscan-stage1hr.o uniqscan-resulthr.o uniqscan-datadir.o uniqscan-getopt.o uniqscan-getopt1.o uniqscan-uniqscan.o -lm libtool: link: gcc -pthread -DTARGET=\"powerpc-unknown-linux-gnu\" -DGMAPDB=\"/var/cache/gmap\" -DMAX_READLENGTH=250 -DGSNAP=1 -O3 -pthread -o uniqscan uniqscan-except.o uniqscan-assert.o uniqscan-mem.o uniqscan-intlist.o uniqscan-list.o uniqscan-littleendian.o uniqscan-bigendian.o uniqscan-interval.o uniqscan-uintlist.o uniqscan-stopwatch.o uniqscan-access.o uniqscan-iit-read.o uniqscan-md5.o uniqscan-sequence.o uniqscan-reader.o uniqscan-genomicpos.o uniqscan-compress.o uniqscan-cmet.o uniqscan-atoi.o uniqscan-genome.o uniqscan-genome_hr.o uniqscan-indexdb.o uniqscan-indexdb_hr.o uniqscan-oligo.o uniqscan-chrom.o uniqscan-segmentpos.o uniqscan-chrnum.o uniqscan-maxent_hr.o uniqscan-mapq.o uniqscan-shortread.o uniqscan-substring.o uniqscan-stage3hr.o uniqscan-spanningelt.o uniqscan-maxent.o uniqscan-pair.o uniqscan-pairpool.o uniqscan-diag.o uniqscan-diagpool.o uniqscan-orderstat.o uniqscan-oligoindex.o uniqscan-oligoindex_hr.o uniqscan-stage2.o uniqscan-intron.o uniqscan-boyer-moore.o uniqscan-changepoint.o uniqscan-pbinom.o uniqscan-dynprog.o uniqscan-translation.o uniqscan-smooth.o uniqscan-chimera.o uniqscan-stage3.o uniqscan-splicetrie_build.o uniqscan-splicetrie.o uniqscan-stage1hr.o uniqscan-resulthr.o uniqscan-datadir.o uniqscan-getopt.o uniqscan-getopt1.o uniqscan-uniqscan.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-intlist.o `test -f 'intlist.c' || echo './'`intlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-uintlist.o `test -f 'uintlist.c' || echo './'`uintlist.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-chrom.o `test -f 'chrom.c' || echo './'`chrom.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-md5.o `test -f 'md5.c' || echo './'`md5.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-sequence.o `test -f 'sequence.c' || echo './'`sequence.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-genome.o `test -f 'genome.c' || echo './'`genome.c genome.c: In function 'Genome_ntcounts': genome.c:10414:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'genomecomp_read_current': genome.c:339:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'fill_buffer': genome.c:9884:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_get_char': genome.c:10242:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple_alt': genome.c:10136:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] genome.c: In function 'Genome_fill_buffer_simple': genome.c:10040:11: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o snpindex-snpindex.o `test -f 'snpindex.c' || echo './'`snpindex.c snpindex.c: In function 'main': snpindex.c:917:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] snpindex.c:1005:3: warning: format '%d' expects argument of type 'int', but argument 3 has type 'Oligospace_T' [-Wformat] /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o snpindex snpindex-except.o snpindex-assert.o snpindex-mem.o snpindex-intlist.o snpindex-list.o snpindex-littleendian.o snpindex-bigendian.o snpindex-interval.o snpindex-uintlist.o snpindex-stopwatch.o snpindex-access.o snpindex-iit-read.o snpindex-genomicpos.o snpindex-compress.o snpindex-cmet.o snpindex-atoi.o snpindex-genome_hr.o snpindex-indexdb.o snpindex-chrom.o snpindex-md5.o snpindex-sequence.o snpindex-genome.o snpindex-datadir.o snpindex-getopt.o snpindex-getopt1.o snpindex-snpindex.o -lm libtool: link: gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o snpindex snpindex-except.o snpindex-assert.o snpindex-mem.o snpindex-intlist.o snpindex-list.o snpindex-littleendian.o snpindex-bigendian.o snpindex-interval.o snpindex-uintlist.o snpindex-stopwatch.o snpindex-access.o snpindex-iit-read.o snpindex-genomicpos.o snpindex-compress.o snpindex-cmet.o snpindex-atoi.o snpindex-genome_hr.o snpindex-indexdb.o snpindex-chrom.o snpindex-md5.o snpindex-sequence.o snpindex-genome.o snpindex-datadir.o snpindex-getopt.o snpindex-getopt1.o snpindex-snpindex.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o cmetindex-cmetindex.o `test -f 'cmetindex.c' || echo './'`cmetindex.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o cmetindex cmetindex-except.o cmetindex-assert.o cmetindex-mem.o cmetindex-littleendian.o cmetindex-bigendian.o cmetindex-genomicpos.o cmetindex-stopwatch.o cmetindex-access.o cmetindex-interval.o cmetindex-iit-read.o cmetindex-compress.o cmetindex-cmet.o cmetindex-atoi.o cmetindex-genome_hr.o cmetindex-indexdb.o cmetindex-list.o cmetindex-datadir.o cmetindex-getopt.o cmetindex-getopt1.o cmetindex-cmetindex.o -lm libtool: link: gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o cmetindex cmetindex-except.o cmetindex-assert.o cmetindex-mem.o cmetindex-littleendian.o cmetindex-bigendian.o cmetindex-genomicpos.o cmetindex-stopwatch.o cmetindex-access.o cmetindex-interval.o cmetindex-iit-read.o cmetindex-compress.o cmetindex-cmet.o cmetindex-atoi.o cmetindex-genome_hr.o cmetindex-indexdb.o cmetindex-list.o cmetindex-datadir.o cmetindex-getopt.o cmetindex-getopt1.o cmetindex-cmetindex.o -lm -pthread gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-except.o `test -f 'except.c' || echo './'`except.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-assert.o `test -f 'assert.c' || echo './'`assert.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-mem.o `test -f 'mem.c' || echo './'`mem.c mem.c: In function 'Mem_alloc': mem.c:242:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_keep': mem.c:315:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_in': mem.c:379:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_alloc_out': mem.c:443:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc': mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:483:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:533:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_keep': mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:566:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:616:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_in': mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:647:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:690:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_out': mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:720:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:763:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_calloc_no_exception': mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] mem.c:795:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] mem.c: In function 'Mem_resize': mem.c:1079:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-littleendian.o `test -f 'littleendian.c' || echo './'`littleendian.c littleendian.c: In function 'Littleendian_write_uint': littleendian.c:17:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-bigendian.o `test -f 'bigendian.c' || echo './'`bigendian.c bigendian.c: In function 'Bigendian_fileio_read_uint8': bigendian.c:758:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_fileio_read_uint': bigendian.c:457:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] bigendian.c: In function 'Bigendian_write_uint': bigendian.c:296:8: warning: ignoring return value of 'write', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-genomicpos.o `test -f 'genomicpos.c' || echo './'`genomicpos.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-stopwatch.o `test -f 'stopwatch.c' || echo './'`stopwatch.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-access.o `test -f 'access.c' || echo './'`access.c access.c: In function 'Access_mmap': access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:274:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset': access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c:339:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 5 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_rw': access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:409:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] access.c: In function 'Access_mmap_offset_rw': access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'off_t' [-Wformat] access.c:472:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] access.c: In function 'Access_mmap_and_preload': access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] access.c:557:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'off_t' [-Wformat] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-interval.o `test -f 'interval.c' || echo './'`interval.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-iit-read.o `test -f 'iit-read.c' || echo './'`iit-read.c iit-read.c: In function 'read_tree': iit-read.c:1597:2: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t' [-Wformat] iit-read.c: In function 'read_words_debug': iit-read.c:1989:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c:2019:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'size_t' [-Wformat] iit-read.c: In function 'read_annotations': iit-read.c:2201:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2207:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2212:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2223:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2229:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2234:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] iit-read.c:2245:7: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-compress.o `test -f 'compress.c' || echo './'`compress.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-cmet.o `test -f 'cmet.c' || echo './'`cmet.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-atoi.o `test -f 'atoi.c' || echo './'`atoi.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-genome_hr.o `test -f 'genome_hr.c' || echo './'`genome_hr.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-indexdb.o `test -f 'indexdb.c' || echo './'`indexdb.c indexdb.c: In function 'Indexdb_get_filenames': indexdb.c:557:5: warning: format '%ld' expects argument of type 'long int', but argument 5 has type 'int' [-Wformat] indexdb.c: In function 'positions_move_absolute': indexdb.c:1112:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c: In function 'Indexdb_offsets_from_gammas': indexdb.c:1374:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'check_offsets_from_gammas': indexdb.c:1490:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1496:8: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1514:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1536:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:1542:6: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'Indexdb_write_offsets': indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2091:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'unsigned int' [-Wformat] indexdb.c:2094:5: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c:2274:3: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'Oligospace_T' [-Wformat] indexdb.c: In function 'positions_read_multiple': indexdb.c:1148:9: warning: ignoring return value of 'read', declared with attribute warn_unused_result [-Wunused-result] gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-list.o `test -f 'list.c' || echo './'`list.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-datadir.o `test -f 'datadir.c' || echo './'`datadir.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-getopt.o `test -f 'getopt.c' || echo './'`getopt.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-getopt1.o `test -f 'getopt1.c' || echo './'`getopt1.c gcc -DHAVE_CONFIG_H -I. -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -c -o atoiindex-atoiindex.o `test -f 'atoiindex.c' || echo './'`atoiindex.c /bin/bash ../libtool --tag=CC --mode=link gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o atoiindex atoiindex-except.o atoiindex-assert.o atoiindex-mem.o atoiindex-littleendian.o atoiindex-bigendian.o atoiindex-genomicpos.o atoiindex-stopwatch.o atoiindex-access.o atoiindex-interval.o atoiindex-iit-read.o atoiindex-compress.o atoiindex-cmet.o atoiindex-atoi.o atoiindex-genome_hr.o atoiindex-indexdb.o atoiindex-list.o atoiindex-datadir.o atoiindex-getopt.o atoiindex-getopt1.o atoiindex-atoiindex.o -lm libtool: link: gcc -pthread -DGMAPDB=\"/var/cache/gmap\" -O3 -pthread -o atoiindex atoiindex-except.o atoiindex-assert.o atoiindex-mem.o atoiindex-littleendian.o atoiindex-bigendian.o atoiindex-genomicpos.o atoiindex-stopwatch.o atoiindex-access.o atoiindex-interval.o atoiindex-iit-read.o atoiindex-compress.o atoiindex-cmet.o atoiindex-atoi.o atoiindex-genome_hr.o atoiindex-indexdb.o atoiindex-list.o atoiindex-datadir.o atoiindex-getopt.o atoiindex-getopt1.o atoiindex-atoiindex.o -lm -pthread make[3]: Leaving directory `/build/buildd/gmap-2012-06-12/src' make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/src' Making all in util make[2]: Entering directory `/build/buildd/gmap-2012-06-12/util' cp gmap_compress.pl gmap_compress chmod +x gmap_compress cp gmap_uncompress.pl gmap_uncompress chmod +x gmap_uncompress cp gmap_process.pl gmap_process chmod +x gmap_process cp gmap_setup.pl gmap_setup chmod +x gmap_setup cp gmap_build.pl gmap_build chmod +x gmap_build cp gmap_reassemble.pl gmap_reassemble chmod +x gmap_reassemble cp md_coords.pl md_coords chmod +x md_coords cp fa_coords.pl fa_coords chmod +x fa_coords cp psl_splicesites.pl psl_splicesites chmod +x psl_splicesites cp psl_introns.pl psl_introns chmod +x psl_introns cp psl_genes.pl psl_genes chmod +x psl_genes cp gtf_splicesites.pl gtf_splicesites chmod +x gtf_splicesites cp gtf_introns.pl gtf_introns chmod +x gtf_introns cp gtf_genes.pl gtf_genes chmod +x gtf_genes cp gff3_splicesites.pl gff3_splicesites chmod +x gff3_splicesites cp gff3_introns.pl gff3_introns chmod +x gff3_introns cp gff3_genes.pl gff3_genes chmod +x gff3_genes cp dbsnp_iit.pl dbsnp_iit chmod +x dbsnp_iit make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/util' Making all in tests make[2]: Entering directory `/build/buildd/gmap-2012-06-12/tests' make[2]: Nothing to be done for `all'. make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/tests' make[2]: Entering directory `/build/buildd/gmap-2012-06-12' make[2]: Nothing to be done for `all-am'. make[2]: Leaving directory `/build/buildd/gmap-2012-06-12' make[1]: Leaving directory `/build/buildd/gmap-2012-06-12' dh_auto_test -a make[1]: Entering directory `/build/buildd/gmap-2012-06-12' Making check in src make[2]: Entering directory `/build/buildd/gmap-2012-06-12/src' make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/src' Making check in util make[2]: Entering directory `/build/buildd/gmap-2012-06-12/util' make[2]: Nothing to be done for `check'. make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/util' Making check in tests make[2]: Entering directory `/build/buildd/gmap-2012-06-12/tests' make check-TESTS make[3]: Entering directory `/build/buildd/gmap-2012-06-12/tests' GMAP version 2012-06-12 called with args: /build/buildd/gmap-2012-06-12/src/gmap -A -g /build/buildd/gmap-2012-06-12/tests/ss.chr17test /build/buildd/gmap-2012-06-12/tests/ss.her2 No paths found for NM_004448 Processed 1 queries in 0.04 seconds (25.00 queries/sec) 2c2,11 < Paths (0): --- > Paths (1): > Path 1: query 1..4624 (4624 bp) => genome 109,781..138,442 (28662 bp) > cDNA direction: sense > Genomic pos: 109,781..138,442 (+ strand) > Number of exons: 27 > Coverage: 100.0 (query length: 4624 bp) > Trimmed coverage: 100.0 (trimmed length: 4624 bp, trimmed region: 1..4624) > Percent identity: 100.0 (4624 matches, 0 mismatches, 0 indels, 0 unknowns) > Translation: 2..4006 (1334 aa) > Amino acid changes: 4a14,729 > Alignment for path 1: > > 109781-110091 (1-311) 100% -> ...6678... > 116770-116921 (312-463) 100% -> ...1179... > 118101-118314 (464-677) 100% -> ...783... > 119098-119232 (678-812) 100% -> ...360... > 119593-119661 (813-881) 100% -> ...204... > 119866-119981 (882-997) 100% -> ...138... > 120120-120261 (998-1139) 100% -> ...1446... > 121708-121827 (1140-1259) 100% -> ...274... > 122102-122228 (1260-1386) 100% -> ...2837... > 125066-125139 (1387-1460) 100% -> ...86... > 125226-125316 (1461-1551) 100% -> ...203... > 125520-125719 (1552-1751) 100% -> ...361... > 126081-126213 (1752-1884) 100% -> ...81... > 126295-126385 (1885-1975) 100% -> ...714... > 127100-127260 (1976-2136) 100% -> ...2306... > 129567-129614 (2137-2184) 100% -> ...3484... > 133099-133237 (2185-2323) 100% -> ...80... > 133318-133440 (2324-2446) 100% -> ...251... > 133692-133790 (2447-2545) 100% -> ...715... > 134506-134691 (2546-2731) 100% -> ...137... > 134829-134984 (2732-2887) 100% -> ...122... > 135107-135182 (2888-2963) 100% -> ...304... > 135487-135633 (2964-3110) 100% -> ...708... > 136342-136439 (3111-3208) 100% -> ...155... > 136595-136783 (3209-3397) 100% -> ...291... > 137075-137327 (3398-3650) 100% -> ...141... > 137469-138442 (3651-4624) 100% > > 0 . : . : . : . : . : > aa.g 1 E E V E E E G C L R K Y K N E V V > 109781 GGAGGAGGTGGAGGAGGAGGGCTGCTTGAGGAAGTATAAGAATGAAGTTG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1 GGAGGAGGTGGAGGAGGAGGGCTGCTTGAGGAAGTATAAGAATGAAGTTG > aa.c 1 E E V E E E G C L R K Y K N E V V > > 50 . : . : . : . : . : > aa.g 18 K L R F P S I G T G E T R G A P > 109831 TGAAGCTGAGATTCCCCTCCATTGGGACCGGAGAAACCAGGGGAGCCCCC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 51 TGAAGCTGAGATTCCCCTCCATTGGGACCGGAGAAACCAGGGGAGCCCCC > aa.c 18 K L R F P S I G T G E T R G A P > > 100 . : . : . : . : . : > aa.g 34 R A A A R P F P R G P L L R R A P > 109881 CGGGCAGCCGCGCGCCCCTTCCCACGGGGCCCTTTACTGCGCCGCGCGCC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 101 CGGGCAGCCGCGCGCCCCTTCCCACGGGGCCCTTTACTGCGCCGCGCGCC > aa.c 34 R A A A R P F P R G P L L R R A P > > 150 . : . : . : . : . : > aa.g 51 G P H P S Q H P A P R A L P A G S > 109931 CGGCCCCCACCCCTCGCAGCACCCCGCGCCCCGCGCCCTCCCAGCCGGGT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 151 CGGCCCCCACCCCTCGCAGCACCCCGCGCCCCGCGCCCTCCCAGCCGGGT > aa.c 51 G P H P S Q H P A P R A L P A G S > > 200 . : . : . : . : . : > aa.g 68 S R S H G A G A A V S T M E L A > 109981 CCAGCCGGAGCCATGGGGCCGGAGCCGCAGTGAGCACCATGGAGCTGGCG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 201 CCAGCCGGAGCCATGGGGCCGGAGCCGCAGTGAGCACCATGGAGCTGGCG > aa.c 68 S R S H G A G A A V S T M E L A > > 250 . : . : . : . : . : > aa.g 84 A L C R W G L L L A L L P P G A A > 110031 GCCTTGTGCCGCTGGGGGCTCCTCCTCGCCCTCTTGCCCCCCGGAGCCGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 251 GCCTTGTGCCGCTGGGGGCTCCTCCTCGCCCTCTTGCCCCCCGGAGCCGC > aa.c 84 A L C R W G L L L A L L P P G A A > > 300 . : . : . : . : . : > aa.g 101 S T Q V C T G T D M K L R L > 110081 GAGCACCCAAGGTG...CAGTGTGCACCGGCACAGACATGAAGCTGCGGC > |||||||||||>>>...>>>|||||||||||||||||||||||||||||| > 301 GAGCACCCAAG 6678 TGTGCACCGGCACAGACATGAAGCTGCGGC > aa.c 101 S T Q V C T G T D M K L R L > > 350 . : . : . : . : . : > aa.g 115 P A S P E T H L D M L R H L Y Q > 116800 TCCCTGCCAGTCCCGAGACCCACCTGGACATGCTCCGCCACCTCTACCAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 342 TCCCTGCCAGTCCCGAGACCCACCTGGACATGCTCCGCCACCTCTACCAG > aa.c 115 P A S P E T H L D M L R H L Y Q > > 400 . : . : . : . : . : > aa.g 131 G C Q V V Q G N L E L T Y L P T N > 116850 GGCTGCCAGGTGGTGCAGGGAAACCTGGAACTCACCTACCTGCCCACCAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 392 GGCTGCCAGGTGGTGCAGGGAAACCTGGAACTCACCTACCTGCCCACCAA > aa.c 131 G C Q V V Q G N L E L T Y L P T N > > 450 . : . : . : . : . : > aa.g 148 A S L S F L Q D I Q E V Q G > 116900 TGCCAGCCTGTCCTTCCTGCAGGTG...CAGGATATCCAGGAGGTGCAGG > ||||||||||||||||||||||>>>...>>>||||||||||||||||||| > 442 TGCCAGCCTGTCCTTCCTGCAG 1179 GATATCCAGGAGGTGCAGG > aa.c 148 A S L S F L Q D I Q E V Q G > > 500 . : . : . : . : . : > aa.g 162 Y V L I A H N Q V R Q V P L Q R > 118120 GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 483 GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGG > aa.c 162 Y V L I A H N Q V R Q V P L Q R > > 550 . : . : . : . : . : > aa.g 178 L R I V R G T Q L F E D N Y A L A > 118170 CTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 533 CTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGC > aa.c 178 L R I V R G T Q L F E D N Y A L A > > 600 . : . : . : . : . : > aa.g 195 V L D N G D P L N N T T P V T G A > 118220 CGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTCACAGGGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 583 CGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTCACAGGGG > aa.c 195 V L D N G D P L N N T T P V T G A > > 650 . : . : . : . : . : > aa.g 212 S P G G L R E L Q L R S L T E > 118270 CCTCCCCAGGAGGCCTGCGGGAGCTGCAGCTTCGAAGCCTCACAGGTG.. > |||||||||||||||||||||||||||||||||||||||||||||>>>.. > 633 CCTCCCCAGGAGGCCTGCGGGAGCTGCAGCTTCGAAGCCTCACAG 78 > aa.c 212 S P G G L R E L Q L R S L T E > > 700 . : . : . : . : . : > aa.g 227 I L K G G V L I Q R N P Q L C > 119095 .CAGAGATCTTGAAAGGAGGGGTCTTGATCCAGCGGAACCCCCAGCTCTG > .>>>|||||||||||||||||||||||||||||||||||||||||||||| > 678 3 AGATCTTGAAAGGAGGGGTCTTGATCCAGCGGAACCCCCAGCTCTG > aa.c 227 I L K G G V L I Q R N P Q L C > > 750 . : . : . : . : . : > aa.g 242 Y Q D T I L W K D I F H K N N Q L > 119144 CTACCAGGACACGATTTTGTGGAAGGACATCTTCCACAAGAACAACCAGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 724 CTACCAGGACACGATTTTGTGGAAGGACATCTTCCACAAGAACAACCAGC > aa.c 242 Y Q D T I L W K D I F H K N N Q L > > 800 . : . : . : . : . : > aa.g 259 A L T L I D T N R S R A C > 119194 TGGCTCTCACACTGATAGACACCAACCGCTCTCGGGCCTGTA...CAGGC > |||||||||||||||||||||||||||||||||||||||>>>...>>>|| > 774 TGGCTCTCACACTGATAGACACCAACCGCTCTCGGGCCT 360 GC > aa.c 259 A L T L I D T N R S R A C > > 850 . : . : . : . : . : > aa.g 272 H P C S P M C K G S R C W G E S S > 119595 CACCCCTGTTCTCCGATGTGTAAGGGCTCCCGCTGCTGGGGAGAGAGTTC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 815 CACCCCTGTTCTCCGATGTGTAAGGGCTCCCGCTGCTGGGGAGAGAGTTC > aa.c 272 H P C S P M C K G S R C W G E S S > > 900 . : . : . : . : . : > aa.g 289 E D C Q S L T R T V C A G G > 119645 TGAGGATTGTCAGAGCCGTG...CAGTGACGCGCACTGTCTGTGCCGGTG > |||||||||||||||||>>>...>>>|||||||||||||||||||||||| > 865 TGAGGATTGTCAGAGCC 204 TGACGCGCACTGTCTGTGCCGGTG > aa.c 289 E D C Q S L T R T V C A G G > > 950 . : . : . : . : . : > aa.g 303 C A R C K G P L P T D C C H E Q > 119890 GCTGTGCCCGCTGCAAGGGGCCACTGCCCACTGACTGCTGCCATGAGCAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 906 GCTGTGCCCGCTGCAAGGGGCCACTGCCCACTGACTGCTGCCATGAGCAG > aa.c 303 C A R C K G P L P T D C C H E Q > > 1000 . : . : . : . : . : > aa.g 319 C A A G C T G P K H S D C L > 119940 TGTGCTGCCGGCTGCACGGGCCCCAAGCACTCTGACTGCCTGGTA...CA > ||||||||||||||||||||||||||||||||||||||||||>>>...>> > 956 TGTGCTGCCGGCTGCACGGGCCCCAAGCACTCTGACTGCCTG 138 > aa.c 319 C A A G C T G P K H S D C L > > 1050 . : . : . : . : . : > aa.g 333 A C L H F N H S G I C E L H C P A > 120119 GGCCTGCCTCCACTTCAACCACAGTGGCATCTGTGAGCTGCACTGCCCAG > >||||||||||||||||||||||||||||||||||||||||||||||||| > 998 GCCTGCCTCCACTTCAACCACAGTGGCATCTGTGAGCTGCACTGCCCAG > aa.c 333 A C L H F N H S G I C E L H C P A > > 1100 . : . : . : . : . : > aa.g 350 L V T Y N T D T F E S M P N P E > 120169 CCCTGGTCACCTACAACACAGACACGTTTGAGTCCATGCCCAATCCCGAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1047 CCCTGGTCACCTACAACACAGACACGTTTGAGTCCATGCCCAATCCCGAG > aa.c 350 L V T Y N T D T F E S M P N P E > > 1150 . : . : . : . : . : > aa.g 366 G R Y T F G A S C V T A C P Y > 120219 GGCCGGTATACATTCGGCGCCAGCTGTGTGACTGCCTGTCCCTGTG...T > |||||||||||||||||||||||||||||||||||||||||||>>>...> > 1097 GGCCGGTATACATTCGGCGCCAGCTGTGTGACTGCCTGTCCCT 1446 > aa.c 366 G R Y T F G A S C V T A C P Y > > 1200 . : . : . : . : . : > aa.g 381 N Y L S T D V G S C T L V C P L > 121706 AGACAACTACCTTTCTACGGACGTGGGATCCTGCACCCTCGTCTGCCCCC > >>|||||||||||||||||||||||||||||||||||||||||||||||| > 1140 ACAACTACCTTTCTACGGACGTGGGATCCTGCACCCTCGTCTGCCCCC > aa.c 381 N Y L S T D V G S C T L V C P L > > 1250 . : . : . : . : . : > aa.g 397 H N Q E V T A E D G T Q R C E K > 121756 TGCACAACCAAGAGGTGACAGCAGAGGATGGAACACAGCGGTGTGAGAAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1188 TGCACAACCAAGAGGTGACAGCAGAGGATGGAACACAGCGGTGTGAGAAG > aa.c 397 H N Q E V T A E D G T Q R C E K > > 1300 . : . : . : . : . : > aa.g 413 C S K P C A R V C Y G L G M > 121806 TGCAGCAAGCCCTGTGCCCGAGGTA...CAGTGTGCTATGGTCTGGGCAT > ||||||||||||||||||||||>>>...>>>||||||||||||||||||| > 1238 TGCAGCAAGCCCTGTGCCCGAG 274 TGTGCTATGGTCTGGGCAT > aa.c 413 C S K P C A R V C Y G L G M > > 1350 . : . : . : . : . : > aa.g 427 E H L R E V R A V T S A N I Q E F > 122121 GGAGCACTTGCGAGAGGTGAGGGCAGTTACCAGTGCCAATATCCAGGAGT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1279 GGAGCACTTGCGAGAGGTGAGGGCAGTTACCAGTGCCAATATCCAGGAGT > aa.c 427 E H L R E V R A V T S A N I Q E F > > 1400 . : . : . : . : . : > aa.g 444 A G C K K I F G S L A F L P E S > 122171 TTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTCTGCCGGAGAGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1329 TTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTCTGCCGGAGAGC > aa.c 444 A G C K K I F G S L A F L P E S > > 1450 . : . : . : . : . : > aa.g 460 F D G D P A S N T A P L Q P > 122221 TTTGATGGGTA...CAGGGACCCAGCCTCCAACACTGCCCCGCTCCAGCC > ||||||||>>>...>>>||||||||||||||||||||||||||||||||| > 1379 TTTGATGG 2837 GGACCCAGCCTCCAACACTGCCCCGCTCCAGCC > aa.c 460 F D G D P A S N T A P L Q P > > 1500 . : . : . : . : . : > aa.g 474 E Q L Q V F E T L E E I T G > 125099 AGAGCAGCTCCAAGTGTTTGAGACTCTGGAAGAGATCACAGGTG...CAG > |||||||||||||||||||||||||||||||||||||||||>>>...>>> > 1420 AGAGCAGCTCCAAGTGTTTGAGACTCTGGAAGAGATCACAG 86 > aa.c 474 E Q L Q V F E T L E E I T G > > 1550 . : . : . : . : . : > aa.g 488 Y L Y I S A W P D S L P D L S V > 125226 GTTACCTATACATCTCAGCATGGCCGGACAGCCTGCCTGACCTCAGCGTC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1461 GTTACCTATACATCTCAGCATGGCCGGACAGCCTGCCTGACCTCAGCGTC > aa.c 488 Y L Y I S A W P D S L P D L S V > > 1600 . : . : . : . : . : > aa.g 504 F Q N L Q V I R G R I L H N > 125276 TTCCAGAACCTGCAAGTAATCCGGGGACGAATTCTGCACAAGTG...TAG > |||||||||||||||||||||||||||||||||||||||||>>>...>>> > 1511 TTCCAGAACCTGCAAGTAATCCGGGGACGAATTCTGCACAA 203 > aa.c 504 F Q N L Q V I R G R I L H N > > 1650 . : . : . : . : . : > aa.g 518 G A Y S L T L Q G L G I S W L G L > 125520 TGGCGCCTACTCGCTGACCCTGCAAGGGCTGGGCATCAGCTGGCTGGGGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1552 TGGCGCCTACTCGCTGACCCTGCAAGGGCTGGGCATCAGCTGGCTGGGGC > aa.c 518 G A Y S L T L Q G L G I S W L G L > > 1700 . : . : . : . : . : > aa.g 535 R S L R E L G S G L A L I H H N > 125570 TGCGCTCACTGAGGGAACTGGGCAGTGGACTGGCCCTCATCCACCATAAC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1602 TGCGCTCACTGAGGGAACTGGGCAGTGGACTGGCCCTCATCCACCATAAC > aa.c 535 R S L R E L G S G L A L I H H N > > 1750 . : . : . : . : . : > aa.g 551 T H L C F V H T V P W D Q L F R N > 125620 ACCCACCTCTGCTTCGTGCACACGGTGCCCTGGGACCAGCTCTTTCGGAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1652 ACCCACCTCTGCTTCGTGCACACGGTGCCCTGGGACCAGCTCTTTCGGAA > aa.c 551 T H L C F V H T V P W D Q L F R N > > 1800 . : . : . : . : . : > aa.g 568 P H Q A L L H T A N R P E D E C V > 125670 CCCGCACCAAGCTCTGCTCCACACTGCCAACCGGCCAGAGGACGAGTGTG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1702 CCCGCACCAAGCTCTGCTCCACACTGCCAACCGGCCAGAGGACGAGTGTG > aa.c 568 P H Q A L L H T A N R P E D E C V > > 1850 . : . : . : . : . : > aa.g 585 G E G L A C H Q L C A R G > 125720 GTA...CAGTGGGCGAGGGCCTGGCCTGCCACCAGCTGTGCGCCCGAGGG > >>>...>>>||||||||||||||||||||||||||||||||||||||||| > 1752 361 TGGGCGAGGGCCTGGCCTGCCACCAGCTGTGCGCCCGAGGG > aa.c 585 G E G L A C H Q L C A R G > > 1900 . : . : . : . : . : > aa.g 598 H C W G P G P T Q C V N C S Q F L > 126122 CACTGCTGGGGTCCAGGGCCCACCCAGTGTGTCAACTGCAGCCAGTTCCT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 1793 CACTGCTGGGGTCCAGGGCCCACCCAGTGTGTCAACTGCAGCCAGTTCCT > aa.c 598 H C W G P G P T Q C V N C S Q F L > > 1950 . : . : . : . : . : > aa.g 615 R G Q E C V E E C R V L Q G > 126172 TCGGGGCCAGGAGTGCGTGGAGGAATGCCGAGTACTGCAGGGGTA...CA > ||||||||||||||||||||||||||||||||||||||||||>>>...>> > 1843 TCGGGGCCAGGAGTGCGTGGAGGAATGCCGAGTACTGCAGGG 81 > aa.c 615 R G Q E C V E E C R V L Q G > > 2000 . : . : . : . : . : > aa.g 629 L P R E Y V N A R H C L P C H P > 126294 GGCTCCCCAGGGAGTATGTGAATGCCAGGCACTGTTTGCCGTGCCACCCT > >||||||||||||||||||||||||||||||||||||||||||||||||| > 1885 GCTCCCCAGGGAGTATGTGAATGCCAGGCACTGTTTGCCGTGCCACCCT > aa.c 629 L P R E Y V N A R H C L P C H P > > 2050 . : . : . : . : . : > aa.g 645 E C Q P Q N G S V T C F G P > 126344 GAGTGTCAGCCCCAGAATGGCTCAGTGACCTGTTTTGGACCGGTG...CA > ||||||||||||||||||||||||||||||||||||||||||>>>...>> > 1934 GAGTGTCAGCCCCAGAATGGCTCAGTGACCTGTTTTGGACCG 714 > aa.c 645 E C Q P Q N G S V T C F G P > > 2100 . : . : . : . : . : > aa.g 659 E A D Q C V A C A H Y K D P P F C > 127099 GGAGGCTGACCAGTGTGTGGCCTGTGCCCACTATAAGGACCCTCCCTTCT > >||||||||||||||||||||||||||||||||||||||||||||||||| > 1976 GAGGCTGACCAGTGTGTGGCCTGTGCCCACTATAAGGACCCTCCCTTCT > aa.c 659 E A D Q C V A C A H Y K D P P F C > > 2150 . : . : . : . : . : > aa.g 676 V A R C P S G V K P D L S Y M P > 127149 GCGTGGCCCGCTGCCCCAGCGGTGTGAAACCTGACCTCTCCTACATGCCC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2025 GCGTGGCCCGCTGCCCCAGCGGTGTGAAACCTGACCTCTCCTACATGCCC > aa.c 676 V A R C P S G V K P D L S Y M P > > 2200 . : . : . : . : . : > aa.g 692 I W K F P D E E G A C Q P C P I N > 127199 ATCTGGAAGTTTCCAGATGAGGAGGGCGCATGCCAGCCTTGCCCCATCAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2075 ATCTGGAAGTTTCCAGATGAGGAGGGCGCATGCCAGCCTTGCCCCATCAA > aa.c 692 I W K F P D E E G A C Q P C P I N > > 2250 . : . : . : . : . : > aa.g 709 C T H S C V D L D D K G C P > 127249 CTGCACCCACTCGTG...CAGCTGTGTGGACCTGGATGACAAGGGCTGCC > ||||||||||||>>>...>>>||||||||||||||||||||||||||||| > 2125 CTGCACCCACTC 2306 CTGTGTGGACCTGGATGACAAGGGCTGCC > aa.c 709 C T H S C V D L D D K G C P > > 2300 . : . : . : . : . : > aa.g 723 A E Q R A S P L T S I I S > 129596 CCGCCGAGCAGAGAGCCAGGTT...CAGCCCTCTGACGTCCATCATCTCT > |||||||||||||||||||>>>...>>>|||||||||||||||||||||| > 2166 CCGCCGAGCAGAGAGCCAG 3484 CCCTCTGACGTCCATCATCTCT > aa.c 723 A E Q R A S P L T S I I S > > 2350 . : . : . : . : . : > aa.g 736 A V V G I L L V V V L G V V F G I > 133121 GCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGGAT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2207 GCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGGAT > aa.c 736 A V V G I L L V V V L G V V F G I > > 2400 . : . : . : . : . : > aa.g 753 L I K R R Q Q K I R K Y T M R R L > 133171 CCTCATCAAGCGACGGCAGCAGAAGATCCGGAAGTACACGATGCGGAGAC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2257 CCTCATCAAGCGACGGCAGCAGAAGATCCGGAAGTACACGATGCGGAGAC > aa.c 753 L I K R R Q Q K I R K Y T M R R L > > 2450 . : . : . : . : . : > aa.g 770 L Q E T E L V E P L T P S > 133221 TGCTGCAGGAAACGGAGGTG...CAGCTGGTGGAGCCGCTGACACCTAGC > |||||||||||||||||>>>...>>>|||||||||||||||||||||||| > 2307 TGCTGCAGGAAACGGAG 80 CTGGTGGAGCCGCTGACACCTAGC > aa.c 770 L Q E T E L V E P L T P S > > 2500 . : . : . : . : . : > aa.g 783 G A M P N Q A Q M R I L K E T E L > 133342 GGAGCGATGCCCAACCAGGCGCAGATGCGGATCCTGAAAGAGACGGAGCT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2348 GGAGCGATGCCCAACCAGGCGCAGATGCGGATCCTGAAAGAGACGGAGCT > aa.c 783 G A M P N Q A Q M R I L K E T E L > > 2550 . : . : . : . : . : > aa.g 800 R K V K V L G S G A F G T V Y K > 133392 GAGGAAGGTGAAGGTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAGG > |||||||||||||||||||||||||||||||||||||||||||||||||> > 2398 GAGGAAGGTGAAGGTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAG > aa.c 800 R K V K V L G S G A F G T V Y K > > 2600 . : . : . : . : . : > aa.g 816 G I W I P D G E N V K I P V > 133442 TC...CAGGGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTG > >>...>>>|||||||||||||||||||||||||||||||||||||||||| > 2447 251 GGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTG > aa.c 816 G I W I P D G E N V K I P V > > 2650 . : . : . : . : . : > aa.g 830 A I K V L R E N T S P K A N K E I > 133734 GCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCCAACAAAGAAAT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2489 GCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCCAACAAAGAAAT > aa.c 830 A I K V L R E N T S P K A N K E I > > 2700 . : . : . : . : . : > aa.g 847 L D E A Y V M A G V G S P Y > 133784 CTTAGACGTA...CAGGAAGCATACGTGATGGCTGGTGTGGGCTCCCCAT > |||||||>>>...>>>|||||||||||||||||||||||||||||||||| > 2539 CTTAGAC 715 GAAGCATACGTGATGGCTGGTGTGGGCTCCCCAT > aa.c 847 L D E A Y V M A G V G S P Y > > 2750 . : . : . : . : . : > aa.g 861 V S R L L G I C L T S T V Q L V > 134540 ATGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2580 ATGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGTG > aa.c 861 V S R L L G I C L T S T V Q L V > > 2800 . : . : . : . : . : > aa.g 877 T Q L M P Y G C L L D H V R E N R > 134590 ACACAGCTTATGCCCTATGGCTGCCTCTTAGACCATGTCCGGGAAAACCG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2630 ACACAGCTTATGCCCTATGGCTGCCTCTTAGACCATGTCCGGGAAAACCG > aa.c 877 T Q L M P Y G C L L D H V R E N R > > 2850 . : . : . : . : . : > aa.g 894 G R L G S Q D L L N W C M Q I A K > 134640 CGGACGCCTGGGCTCCCAGGACCTGCTGAACTGGTGTATGCAGATTGCCA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2680 CGGACGCCTGGGCTCCCAGGACCTGCTGAACTGGTGTATGCAGATTGCCA > aa.c 894 G R L G S Q D L L N W C M Q I A K > > 2900 . : . : . : . : . : > aa.g 911 G M S Y L E D V R L V H R > 134690 AGGTA...CAGGGGATGAGCTACCTGGAGGATGTGCGGCTCGTACACAGG > ||>>>...>>>||||||||||||||||||||||||||||||||||||||| > 2730 AG 137 GGGATGAGCTACCTGGAGGATGTGCGGCTCGTACACAGG > aa.c 911 G M S Y L E D V R L V H R > > 2950 . : . : . : . : . : > aa.g 924 D L A A R N V L V K S P N H V K I > 134868 GACTTGGCCGCTCGGAACGTGCTGGTCAAGAGTCCCAACCATGTCAAAAT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2771 GACTTGGCCGCTCGGAACGTGCTGGTCAAGAGTCCCAACCATGTCAAAAT > aa.c 924 D L A A R N V L V K S P N H V K I > > 3000 . : . : . : . : . : > aa.g 941 T D F G L A R L L D I D E T E Y H > 134918 TACAGACTTCGGGCTGGCTCGGCTGCTGGACATTGACGAGACAGAGTACC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2821 TACAGACTTCGGGCTGGCTCGGCTGCTGGACATTGACGAGACAGAGTACC > aa.c 941 T D F G L A R L L D I D E T E Y H > > 3050 . : . : . : . : . : > aa.g 958 A D G G K V P I K W M A L > 134968 ATGCAGATGGGGGCAAGGTT...CAGGTGCCCATCAAGTGGATGGCGCTG > |||||||||||||||||>>>...>>>|||||||||||||||||||||||| > 2871 ATGCAGATGGGGGCAAG 122 GTGCCCATCAAGTGGATGGCGCTG > aa.c 958 A D G G K V P I K W M A L > > 3100 . : . : . : . : . : > aa.g 971 E S I L R R R F T H Q S D V W S Y > 135131 GAGTCCATTCTCCGCCGGCGGTTCACCCACCAGAGTGATGTGTGGAGTTA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 2912 GAGTCCATTCTCCGCCGGCGGTTCACCCACCAGAGTGATGTGTGGAGTTA > aa.c 971 E S I L R R R F T H Q S D V W S Y > > 3150 . : . : . : . : . : > aa.g 988 G V T V W E L M T F G A K P > 135181 TGGTG...TAGGTGTGACTGTGTGGGAGCTGATGACTTTTGGGGCCAAAC > ||>>>...>>>||||||||||||||||||||||||||||||||||||||| > 2962 TG 304 GTGTGACTGTGTGGGAGCTGATGACTTTTGGGGCCAAAC > aa.c 988 G V T V W E L M T F G A K P > > 3200 . : . : . : . : . : > aa.g 1002 Y D G I P A R E I P D L L E K G > 135526 CTTACGATGGGATCCCAGCCCGGGAGATCCCTGACCTGCTGGAAAAGGGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3003 CTTACGATGGGATCCCAGCCCGGGAGATCCCTGACCTGCTGGAAAAGGGG > aa.c 1002 Y D G I P A R E I P D L L E K G > > 3250 . : . : . : . : . : > aa.g 1018 E R L P Q P P I C T I D V Y M I M > 135576 GAGCGGCTGCCCCAGCCCCCCATCTGCACCATTGATGTCTACATGATCAT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3053 GAGCGGCTGCCCCAGCCCCCCATCTGCACCATTGATGTCTACATGATCAT > aa.c 1018 E R L P Q P P I C T I D V Y M I M > > 3300 . : . : . : . : . : > aa.g 1035 V K C W M I D S E C R P R F > 135626 GGTCAAATGTG...CAGGTTGGATGATTGACTCTGAATGTCGGCCAAGAT > ||||||||>>>...>>>||||||||||||||||||||||||||||||||| > 3103 GGTCAAAT 708 GTTGGATGATTGACTCTGAATGTCGGCCAAGAT > aa.c 1035 V K C W M I D S E C R P R F > > 3350 . : . : . : . : . : > aa.g 1049 R E L V S E F S R M A R D P Q R > 136375 TCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3144 TCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGC > aa.c 1049 R E L V S E F S R M A R D P Q R > > 3400 . : . : . : . : . : > aa.g 1065 F V V I Q N E D L G P A S P > 136425 TTTGTGGTCATCCAGGTA...CAGAATGAGGACTTGGGCCCAGCCAGTCC > |||||||||||||||>>>...>>>|||||||||||||||||||||||||| > 3194 TTTGTGGTCATCCAG 155 AATGAGGACTTGGGCCCAGCCAGTCC > aa.c 1065 F V V I Q N E D L G P A S P > > 3450 . : . : . : . : . : > aa.g 1079 L D S T F Y R S L L E D D D M G D > 136621 CTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3235 CTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGG > aa.c 1079 L D S T F Y R S L L E D D D M G D > > 3500 . : . : . : . : . : > aa.g 1096 L V D A E E Y L V P Q Q G F F C > 136671 ACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3285 ACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGT > aa.c 1096 L V D A E E Y L V P Q Q G F F C > > 3550 . : . : . : . : . : > aa.g 1112 P D P A P G A G G M V H H R H R S > 136721 CCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3335 CCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAG > aa.c 1112 P D P A P G A G G M V H H R H R S > > 3600 . : . : . : . : . : > aa.g 1129 S S T R S G G G D L T L G L > 136771 CTCATCTACCAGGGTC...CAGAGTGGCGGTGGGGACCTGACACTAGGGC > |||||||||||||>>>...>>>|||||||||||||||||||||||||||| > 3385 CTCATCTACCAGG 291 AGTGGCGGTGGGGACCTGACACTAGGGC > aa.c 1129 S S T R S G G G D L T L G L > > 3650 . : . : . : . : . : > aa.g 1143 E P S E E E A P R S P L A P S E > 137103 TGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3426 TGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAA > aa.c 1143 E P S E E E A P R S P L A P S E > > 3700 . : . : . : . : . : > aa.g 1159 G A G S D V F D G D L G M G A A K > 137153 GGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAATGGGGGCAGCCAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3476 GGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAATGGGGGCAGCCAA > aa.c 1159 G A G S D V F D G D L G M G A A K > > 3750 . : . : . : . : . : > aa.g 1176 G L Q S L P T H D P S P L Q R Y S > 137203 GGGGCTGCAAAGCCTCCCCACACATGACCCCAGCCCTCTACAGCGGTACA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3526 GGGGCTGCAAAGCCTCCCCACACATGACCCCAGCCCTCTACAGCGGTACA > aa.c 1176 G L Q S L P T H D P S P L Q R Y S > > 3800 . : . : . : . : . : > aa.g 1193 E D P T V P L P S E T D G Y V A > 137253 GTGAGGACCCCACAGTACCCCTGCCCTCTGAGACTGATGGCTACGTTGCC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3576 GTGAGGACCCCACAGTACCCCTGCCCTCTGAGACTGATGGCTACGTTGCC > aa.c 1193 E D P T V P L P S E T D G Y V A > > 3850 . : . : . : . : . : > aa.g 1209 P L T C S P Q P E Y V N Q P > 137303 CCCCTGACCTGCAGCCCCCAGCCTGGTA...CAGAATATGTGAACCAGCC > |||||||||||||||||||||||||>>>...>>>|||||||||||||||| > 3626 CCCCTGACCTGCAGCCCCCAGCCTG 141 AATATGTGAACCAGCC > aa.c 1209 P L T C S P Q P E Y V N Q P > > 3900 . : . : . : . : . : > aa.g 1223 D V R P Q P P S P R E G P L P A A > 137485 AGATGTTCGGCCCCAGCCCCCTTCGCCCCGAGAGGGCCCTCTGCCTGCTG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3667 AGATGTTCGGCCCCAGCCCCCTTCGCCCCGAGAGGGCCCTCTGCCTGCTG > aa.c 1223 D V R P Q P P S P R E G P L P A A > > 3950 . : . : . : . : . : > aa.g 1240 R P A G A T L E R P K T L S P G > 137535 CCCGACCTGCTGGTGCCACTCTGGAAAGGCCCAAGACTCTCTCCCCAGGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3717 CCCGACCTGCTGGTGCCACTCTGGAAAGGCCCAAGACTCTCTCCCCAGGG > aa.c 1240 R P A G A T L E R P K T L S P G > > 4000 . : . : . : . : . : > aa.g 1256 K N G V V K D V F A F G G A V E N > 137585 AAGAATGGGGTCGTCAAAGACGTTTTTGCCTTTGGGGGTGCCGTGGAGAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3767 AAGAATGGGGTCGTCAAAGACGTTTTTGCCTTTGGGGGTGCCGTGGAGAA > aa.c 1256 K N G V V K D V F A F G G A V E N > > 4050 . : . : . : . : . : > aa.g 1273 P E Y L T P Q G G A A P Q P H P P > 137635 CCCCGAGTACTTGACACCCCAGGGAGGAGCTGCCCCTCAGCCCCACCCTC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3817 CCCCGAGTACTTGACACCCCAGGGAGGAGCTGCCCCTCAGCCCCACCCTC > aa.c 1273 P E Y L T P Q G G A A P Q P H P P > > 4100 . : . : . : . : . : > aa.g 1290 P A F S P A F D N L Y Y W D Q D > 137685 CTCCTGCCTTCAGCCCAGCCTTCGACAACCTCTATTACTGGGACCAGGAC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3867 CTCCTGCCTTCAGCCCAGCCTTCGACAACCTCTATTACTGGGACCAGGAC > aa.c 1290 P A F S P A F D N L Y Y W D Q D > > 4150 . : . : . : . : . : > aa.g 1306 P P E R G A P P S T F K G T P T A > 137735 CCACCAGAGCGGGGGGCTCCACCCAGCACCTTCAAAGGGACACCTACGGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3917 CCACCAGAGCGGGGGGCTCCACCCAGCACCTTCAAAGGGACACCTACGGC > aa.c 1306 P P E R G A P P S T F K G T P T A > > 4200 . : . : . : . : . : > aa.g 1323 E N P E Y L G L D V P V * > 137785 AGAGAACCCAGAGTACCTGGGTCTGGACGTGCCAGTGTGAACCAGAAGGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 3967 AGAGAACCCAGAGTACCTGGGTCTGGACGTGCCAGTGTGAACCAGAAGGC > aa.c 1323 E N P E Y L G L D V P V * > > 4250 . : . : . : . : . : > > 137835 CAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGAC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4017 CAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGAC > > > 4300 . : . : . : . : . : > > 137885 TTCTGCTGGCATCAAGAGGTGGGAGGGCCCTCCGACCACTTCCAGGGGAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4067 TTCTGCTGGCATCAAGAGGTGGGAGGGCCCTCCGACCACTTCCAGGGGAA > > > 4350 . : . : . : . : . : > > 137935 CCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGAGTT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4117 CCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGAGTT > > > 4400 . : . : . : . : . : > > 137985 CCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4167 CCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGG > > > 4450 . : . : . : . : . : > > 138035 GGAGTCTTTGTGGATTCTGAGGCCCTGCCCAATGAGACTCTAGGGTCCAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4217 GGAGTCTTTGTGGATTCTGAGGCCCTGCCCAATGAGACTCTAGGGTCCAG > > > 4500 . : . : . : . : . : > > 138085 TGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4267 TGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGA > > > 4550 . : . : . : . : . : > > 138135 AAGCCTTAGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4317 AAGCCTTAGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTC > > > 4600 . : . : . : . : . : > > 138185 TAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGAAACCTAGTACTGC > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4367 TAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGAAACCTAGTACTGC > > > 4650 . : . : . : . : . : > > 138235 CCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4417 CCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAG > > > 4700 . : . : . : . : . : > > 138285 AGTGCTTTTCTGTTTAGTTTTTACTTTTTTTGTTTTGTTTTTTTAAAGAT > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4467 AGTGCTTTTCTGTTTAGTTTTTACTTTTTTTGTTTTGTTTTTTTAAAGAT > > > 4750 . : . : . : . : . : > > 138335 GAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGTGTG > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4517 GAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGTGTG > > > 4800 . : . : . : . : . : > > 138385 GGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAA > |||||||||||||||||||||||||||||||||||||||||||||||||| > 4567 GGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAA > > > 4850 . > > 138435 AACAGCTA > |||||||| > 4617 AACAGCTA > > FAIL: align.test Opening file /build/buildd/gmap-2012-06-12/tests/ss.chr17test Processed short contigs (<1000000 nt): . ============================================================ Contig mapping information has been written to file coords.chr17test. You should look at this file, and edit it if necessary If everything is okay, you should proceed by running make -f Makefile.chr17test gmapdb ============================================================ PASS: coords1.test ============================================================ A Makefile called Makefile.chr17test has been created for your genome. You may inspect and edit it if necessary. To start the build of your genome, do make -f Makefile.chr17test coords make -f Makefile.chr17test gmapdb make -f Makefile.chr17test install If you need to start over again, do make -f Makefile.chr17test clean (which preserves Makefile.chr17test and INSTALL.chr17test) or make -f Makefile.chr17test cleanall (which deletes the above files) A copy of these commands has been written to a file called INSTALL.chr17test. ============================================================ make[4]: Entering directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' for s in chromosome chromosome.iit chrsubset contig contig.iit genome genomecomp genomealt version id*offsetscomp id*positions ref*gammaptrs ref*offsetscomp ref*positions snp*gammaptrs snp*offsetscomp snp*positions pf*gammaptrs pf*offsetscomp pf*positions pr*gammaptrs pr*offsetscomp pr*positions; do \ rm -f chr17test.$s; \ done; /build/buildd/gmap-2012-06-12/src/fa_coords -o coords.chr17test /build/buildd/gmap-2012-06-12/tests/ss.chr17test Opening file /build/buildd/gmap-2012-06-12/tests/ss.chr17test Processed short contigs (<1000000 nt): . ============================================================ Contig mapping information has been written to file coords.chr17test. You should look at this file, and edit it if necessary If everything is okay, you should proceed by running make -f Makefile.chr17test gmapdb ============================================================ make[4]: Leaving directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' make[4]: Entering directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' if test -s coords.chr17test; then \ echo File coords.chr17test found. Proceeding...; \ else \ echo File coords.chr17test not found. Please run "make -f Makefile.chr17test coords" first.; \ exit 1; \ fi File coords.chr17test found. Proceeding... echo chr17test > chr17test.version echo Making contig files... Making contig files... /build/buildd/gmap-2012-06-12/src/gmap_process -c coords.chr17test /build/buildd/gmap-2012-06-12/tests/ss.chr17test | /build/buildd/gmap-2012-06-12/src/gmapindex -d chr17test -A Reading coordinates from file coords.chr17test Logging contig chr17test at chr17test:1..200000 in genome chr17test Total genomic length = 200000 bp Chromosome chr17test has universal coordinates 1..200000 Writing IIT file header information...done Processing null division/chromosome...sorting...writing...done (1 intervals) Writing IIT file footer information...done Writing IIT file header information...done Processing null division/chromosome...sorting...writing...done (1 intervals) Writing IIT file footer information...done echo Making compressed genome file... Making compressed genome file... /build/buildd/gmap-2012-06-12/src/gmap_process -c coords.chr17test /build/buildd/gmap-2012-06-12/tests/ss.chr17test | /build/buildd/gmap-2012-06-12/src/gmapindex -d chr17test -G Genome length is 200000 nt Trying to allocate 18750*4 bytes of memory...succeeded. Building genome in memory. Reading coordinates from file coords.chr17test Writing contig chr17test to universal coordinates 1..200000 in genome chr17test A total of 0 non-ACGTNX characters were seen in the genome. echo Making index offsetscomp file... Making index offsetscomp file... cat chr17test.genomecomp | /build/buildd/gmap-2012-06-12/src/gmapindex -d chr17test -k 12 -q 3 -O; Allocating 274190744*0 bytes for offsets Indexing offsets of oligomers in genome chr17test (12 bp every 3 bp), position 0 Writing 16384 offsets compressed to file with total of 0 positions...done echo Making index positions file... Making index positions file... if test -s chr17test.genome; then \ cat chr17test.genome | /build/buildd/gmap-2012-06-12/src/gmapindex -d chr17test -l -k 12 -q 3 -P ; \ else \ cat chr17test.genomecomp | /build/buildd/gmap-2012-06-12/src/gmapindex -d chr17test -k 12 -q 3 -P ; \ fi Trying to allocate 66663*4 bytes of memory...succeeded. Building positions in memory. Indexing positions of oligomers in genome chr17test (12 bp every 3 bp), position 0 Writing 66663 genomic positions to file ./chr17test.ref123positions ... echo gmapdb for chr17test complete. gmapdb for chr17test complete. echo To install, do: make -f Makefile.chr17test install To install, do: make -f Makefile.chr17test install make[4]: Leaving directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' make[4]: Entering directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' mkdir -p ./chr17test for s in chromosome chromosome.iit chrsubset contig contig.iit genome genomecomp genomealt version id*offsetscomp id*positions ref*gammaptrs ref*offsetscomp ref*positions snp*gammaptrs snp*offsetscomp snp*positions pf*gammaptrs pf*offsetscomp pf*positions pr*gammaptrs pr*offsetscomp pr*positions; do \ if test -r chr17test.$s; then \ mv -f chr17test.$s ./chr17test; \ fi \ done chmod 644 ./chr17test/chr17test.* mkdir -p ./chr17test/chr17test.maps chmod 755 ./chr17test/chr17test.maps make[4]: Leaving directory `/build/buildd/gmap-2012-06-12/tests/testSubDir' GMAP version 2012-06-12 called with args: /build/buildd/gmap-2012-06-12/src/gmap -D . -d chr17test /build/buildd/gmap-2012-06-12/tests/ss.her2 Looking for index files in directory ./chr17test No gammaptrs file, because kmersize 12 == basesize 12 Offsetscomp file is chr17test.ref12123offsetscomp Positions file is chr17test.ref123positions Processed 1 queries in 0.04 seconds (25.00 queries/sec) PASS: setup1.test Finished reading FASTA file -- total entries: 3 Total label length: 0 + 0 separators Total annotation length: 16384 + 0 separators Saw 0 distinct divisions/chromosomes Saw 3 distinct tags/types Writing IIT file header information...done Processing null division/chromosome...sorting...writing...done (3 intervals) Writing IIT file footer information...done PASS: iit.test ========================================= 1 of 4 tests failed Please report to Thomas Wu ========================================= make[3]: *** [check-TESTS] Error 1 make[3]: Leaving directory `/build/buildd/gmap-2012-06-12/tests' make[2]: *** [check-am] Error 2 make[2]: Leaving directory `/build/buildd/gmap-2012-06-12/tests' make[1]: *** [check-recursive] Error 1 make[1]: Leaving directory `/build/buildd/gmap-2012-06-12' dh_auto_test: make -j1 check returned exit code 2 make: *** [build-arch] Error 29 dpkg-buildpackage: error: debian/rules build-arch gave error exit status 2 ****************************************************************************** Build finished at 20130423-1951 FAILED [dpkg-buildpackage died] ****************************************************************************** Finished at 20130423-1951 Build needed 00:03:30, 129600k disk space RUN: /usr/share/launchpad-buildd/slavebin/scan-for-processes ['/usr/share/launchpad-buildd/slavebin/scan-for-processes', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd'] Scanning for processes to kill in build /home/buildd/build-2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd/chroot-autobuild... RUN: /usr/share/launchpad-buildd/slavebin/umount-chroot ['umount-chroot', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd'] Unmounting chroot for build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd... RUN: /usr/share/launchpad-buildd/slavebin/remove-build ['remove-build', '2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd'] Removing build 2dd2b21ec0d40b7b4421deb8fa81bbad5f3a81cd