https://launchpad.net/ubuntu/+source/seqprep/1.3.2-3/+build/15101291 RUN: /usr/share/launchpad-buildd/slavebin/slave-prep Forking launchpad-buildd slave process... Kernel version: Linux bos02-arm64-018 4.4.0-130-generic #156-Ubuntu SMP Thu Jun 14 08:52:48 UTC 2018 aarch64 Buildd toolchain package versions: launchpad-buildd_163 python-lpbuildd_163 sbuild_0.67.0-2ubuntu7.1 bzr-builder_0.7.3+bzr174~ppa13~ubuntu14.10.1 bzr_2.7.0-2ubuntu3.1 git-build-recipe_0.3.4~git201611291343.dcee459~ubuntu16.04.1 git_1:2.7.4-0ubuntu1.4 dpkg-dev_1.18.4ubuntu1.4 python-debian_0.1.27ubuntu2. Syncing the system clock with the buildd NTP service... 9 Jul 11:16:11 ntpdate[1866]: adjust time server 10.211.37.1 offset 0.059686 sec RUN: /usr/share/launchpad-buildd/slavebin/in-target unpack-chroot --backend=chroot --series=cosmic --arch=armhf PACKAGEBUILD-15101291 /home/buildd/filecache-default/fc6c56f66744d62233b3c844f67cb7d83d839bbc Creating target for build PACKAGEBUILD-15101291 RUN: /usr/share/launchpad-buildd/slavebin/in-target mount-chroot --backend=chroot --series=cosmic --arch=armhf PACKAGEBUILD-15101291 Starting target for build PACKAGEBUILD-15101291 RUN: /usr/share/launchpad-buildd/slavebin/in-target override-sources-list --backend=chroot --series=cosmic --arch=armhf PACKAGEBUILD-15101291 'deb http://ftpmaster.internal/ubuntu cosmic main universe' 'deb http://ftpmaster.internal/ubuntu cosmic-security main universe' 'deb http://ftpmaster.internal/ubuntu cosmic-updates main universe' 'deb http://ftpmaster.internal/ubuntu cosmic-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-15101291 RUN: /usr/share/launchpad-buildd/slavebin/in-target update-debian-chroot --backend=chroot --series=cosmic --arch=armhf PACKAGEBUILD-15101291 Updating target for build PACKAGEBUILD-15101291 Get:1 http://ftpmaster.internal/ubuntu cosmic InRelease [242 kB] Get:2 http://ftpmaster.internal/ubuntu cosmic-security InRelease [65.4 kB] Get:3 http://ftpmaster.internal/ubuntu cosmic-updates InRelease [65.4 kB] Get:4 http://ftpmaster.internal/ubuntu cosmic-proposed InRelease [92.5 kB] Get:5 http://ftpmaster.internal/ubuntu cosmic/main armhf Packages [970 kB] Get:6 http://ftpmaster.internal/ubuntu cosmic/main Translation-en [516 kB] Get:7 http://ftpmaster.internal/ubuntu cosmic/universe armhf Packages [8397 kB] Get:8 http://ftpmaster.internal/ubuntu cosmic/universe Translation-en [5019 kB] Get:9 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf Packages [53.2 kB] Get:10 http://ftpmaster.internal/ubuntu cosmic-proposed/main Translation-en [32.2 kB] Get:11 http://ftpmaster.internal/ubuntu cosmic-proposed/universe armhf Packages [148 kB] Get:12 http://ftpmaster.internal/ubuntu cosmic-proposed/universe Translation-en [86.1 kB] Fetched 15.7 MB in 6s (2541 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages were automatically installed and are no longer required: libncursesw5 libprocps6 Use 'sudo apt autoremove' to remove them. The following NEW packages will be installed: libargon2-1 libncurses6 libncursesw6 libprocps7 libtinfo6 The following packages will be upgraded: adduser apt base-files base-passwd bash binutils binutils-arm-linux-gnueabihf binutils-common bsdutils build-essential cpp cpp-7 debconf debianutils dpkg dpkg-dev e2fslibs e2fsprogs fdisk g++ g++-7 gcc gcc-7 gcc-7-base gcc-8-base gpg gpg-agent gpgconf gpgv libapparmor1 libapt-pkg5.0 libargon2-0 libasan4 libatomic1 libaudit-common libaudit1 libbinutils libblkid1 libcap-ng0 libcc1-0 libcilkrts5 libcom-err2 libcomerr2 libcryptsetup12 libdpkg-perl libext2fs2 libfdisk1 libgcc-7-dev libgcc1 libgcrypt20 libgmp10 libgomp1 libgpg-error0 libkmod2 liblz4-1 libmount1 libncurses5 libncursesw5 libnpth0 libp11-kit0 libperl5.26 libreadline7 libseccomp2 libselinux1 libsemanage-common libsemanage1 libsepol1 libslang2 libsmartcols1 libsqlite3-0 libss2 libssl1.1 libstdc++-7-dev libstdc++6 libsystemd0 libtasn1-6 libtinfo5 libubsan0 libudev1 libusb-0.1-4 libuuid1 linux-libc-dev mount ncurses-base ncurses-bin openssl perl perl-base perl-modules-5.26 pinentry-curses pkgbinarymangler procps readline-common sed systemd systemd-sysv tar tzdata util-linux 99 upgraded, 5 newly installed, 0 to remove and 0 not upgraded. Need to get 47.7 MB of archives. After this operation, 1738 kB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu cosmic/main armhf base-files armhf 10.1ubuntu4 [58.0 kB] Get:2 http://ftpmaster.internal/ubuntu cosmic/main armhf libtinfo6 armhf 6.1+20180210-4ubuntu1 [71.2 kB] Get:3 http://ftpmaster.internal/ubuntu cosmic/main armhf debianutils armhf 4.8.6 [84.4 kB] Get:4 http://ftpmaster.internal/ubuntu cosmic/main armhf bash armhf 4.4.18-2ubuntu2 [552 kB] Get:5 http://ftpmaster.internal/ubuntu cosmic/main armhf bsdutils armhf 1:2.32-0.1ubuntu1 [55.5 kB] Get:6 http://ftpmaster.internal/ubuntu cosmic/main armhf tar armhf 1.30+dfsg-2 [218 kB] Get:7 http://ftpmaster.internal/ubuntu cosmic/main armhf dpkg armhf 1.19.0.5ubuntu3 [1096 kB] Get:8 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libext2fs2 armhf 1.44.3~rc2-1 [145 kB] Get:9 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf e2fsprogs armhf 1.44.3~rc2-1 [375 kB] Get:10 http://ftpmaster.internal/ubuntu cosmic/main armhf ncurses-bin armhf 6.1+20180210-4ubuntu1 [155 kB] Get:11 http://ftpmaster.internal/ubuntu cosmic/main armhf perl-modules-5.26 all 5.26.2-6 [2762 kB] Get:12 http://ftpmaster.internal/ubuntu cosmic/main armhf libperl5.26 armhf 5.26.2-6 [2870 kB] Get:13 http://ftpmaster.internal/ubuntu cosmic/main armhf perl armhf 5.26.2-6 [202 kB] Get:14 http://ftpmaster.internal/ubuntu cosmic/main armhf perl-base armhf 5.26.2-6 [1291 kB] Get:15 http://ftpmaster.internal/ubuntu cosmic/main armhf sed armhf 4.5-1 [177 kB] Get:16 http://ftpmaster.internal/ubuntu cosmic/main armhf libuuid1 armhf 2.32-0.1ubuntu1 [19.2 kB] Get:17 http://ftpmaster.internal/ubuntu cosmic/main armhf libblkid1 armhf 2.32-0.1ubuntu1 [115 kB] Get:18 http://ftpmaster.internal/ubuntu cosmic/main armhf libfdisk1 armhf 2.32-0.1ubuntu1 [155 kB] Get:19 http://ftpmaster.internal/ubuntu cosmic/main armhf libncursesw6 armhf 6.1+20180210-4ubuntu1 [104 kB] Get:20 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libselinux1 armhf 2.8-1build1 [59.2 kB] Get:21 http://ftpmaster.internal/ubuntu cosmic/main armhf libmount1 armhf 2.32-0.1ubuntu1 [125 kB] Get:22 http://ftpmaster.internal/ubuntu cosmic/main armhf libsmartcols1 armhf 2.32-0.1ubuntu1 [76.2 kB] Get:23 http://ftpmaster.internal/ubuntu cosmic/main armhf fdisk armhf 2.32-0.1ubuntu1 [98.7 kB] Get:24 http://ftpmaster.internal/ubuntu cosmic/main armhf util-linux armhf 2.32-0.1ubuntu1 [858 kB] Get:25 http://ftpmaster.internal/ubuntu cosmic/main armhf base-passwd armhf 3.5.45 [46.0 kB] Get:26 http://ftpmaster.internal/ubuntu cosmic/main armhf ncurses-base all 6.1+20180210-4ubuntu1 [18.4 kB] Get:27 http://ftpmaster.internal/ubuntu cosmic/main armhf libgomp1 armhf 8.1.0-9ubuntu1 [66.6 kB] Get:28 http://ftpmaster.internal/ubuntu cosmic/main armhf gcc-8-base armhf 8.1.0-9ubuntu1 [18.9 kB] Get:29 http://ftpmaster.internal/ubuntu cosmic/main armhf libgcc1 armhf 1:8.1.0-9ubuntu1 [37.1 kB] Get:30 http://ftpmaster.internal/ubuntu cosmic/main armhf libcc1-0 armhf 8.1.0-9ubuntu1 [32.7 kB] Get:31 http://ftpmaster.internal/ubuntu cosmic/main armhf libatomic1 armhf 8.1.0-9ubuntu1 [7052 B] Get:32 http://ftpmaster.internal/ubuntu cosmic/main armhf libstdc++6 armhf 8.1.0-9ubuntu1 [350 kB] Get:33 http://ftpmaster.internal/ubuntu cosmic/main armhf liblz4-1 armhf 1.8.2-1ubuntu1 [76.1 kB] Get:34 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libudev1 armhf 238-5ubuntu2 [50.7 kB] Get:35 http://ftpmaster.internal/ubuntu cosmic/main armhf libapt-pkg5.0 armhf 1.7.0~alpha1 [732 kB] Get:36 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf debconf all 1.5.67 [124 kB] Get:37 http://ftpmaster.internal/ubuntu cosmic/main armhf adduser all 3.117ubuntu1 [163 kB] Get:38 http://ftpmaster.internal/ubuntu cosmic/main armhf libgpg-error0 armhf 1.31-1 [48.5 kB] Get:39 http://ftpmaster.internal/ubuntu cosmic/main armhf libgcrypt20 armhf 1.8.2-2ubuntu1 [364 kB] Get:40 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf gpgv armhf 2.2.8-1ubuntu1 [167 kB] Get:41 http://ftpmaster.internal/ubuntu cosmic/main armhf libseccomp2 armhf 2.3.3-3ubuntu1 [30.4 kB] Get:42 http://ftpmaster.internal/ubuntu cosmic/main armhf apt armhf 1.7.0~alpha1 [1128 kB] Get:43 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libapparmor1 armhf 2.12-4ubuntu6 [27.1 kB] Get:44 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libaudit-common all 1:2.8.3-1ubuntu2 [4064 B] Get:45 http://ftpmaster.internal/ubuntu cosmic/main armhf libcap-ng0 armhf 0.7.9-1 [10.1 kB] Get:46 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libaudit1 armhf 1:2.8.3-1ubuntu2 [35.5 kB] Get:47 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libargon2-1 armhf 0~20171227-0.1 [20.7 kB] Get:48 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libargon2-0 armhf 0~20171227-0.1 [4536 B] Get:49 http://ftpmaster.internal/ubuntu cosmic/main armhf libcryptsetup12 armhf 2:2.0.2-1ubuntu2 [119 kB] Get:50 http://ftpmaster.internal/ubuntu cosmic/main armhf libkmod2 armhf 25-1ubuntu1 [35.7 kB] Get:51 http://ftpmaster.internal/ubuntu cosmic/main armhf mount armhf 2.32-0.1ubuntu1 [97.4 kB] Get:52 http://ftpmaster.internal/ubuntu cosmic/main armhf libncurses6 armhf 6.1+20180210-4ubuntu1 [78.5 kB] Get:53 http://ftpmaster.internal/ubuntu cosmic/main armhf libprocps7 armhf 2:3.3.15-2ubuntu1 [29.6 kB] Get:54 http://ftpmaster.internal/ubuntu cosmic/main armhf procps armhf 2:3.3.15-2ubuntu1 [219 kB] Get:55 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf systemd armhf 238-5ubuntu2 [2783 kB] Get:56 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libsystemd0 armhf 238-5ubuntu2 [189 kB] Get:57 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf systemd-sysv armhf 238-5ubuntu2 [13.7 kB] Get:58 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libcom-err2 armhf 1.44.3~rc2-1 [8452 B] Get:59 http://ftpmaster.internal/ubuntu cosmic/main armhf libsepol1 armhf 2.8-1 [219 kB] Get:60 http://ftpmaster.internal/ubuntu cosmic/main armhf libsemanage-common all 2.8-1build1 [7000 B] Get:61 http://ftpmaster.internal/ubuntu cosmic/main armhf libsemanage1 armhf 2.8-1build1 [73.0 kB] Get:62 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libss2 armhf 1.44.3~rc2-1 [9392 B] Get:63 http://ftpmaster.internal/ubuntu cosmic/main armhf libgmp10 armhf 2:6.1.2+dfsg-3 [182 kB] Get:64 http://ftpmaster.internal/ubuntu cosmic/main armhf libp11-kit0 armhf 0.23.12-2 [163 kB] Get:65 http://ftpmaster.internal/ubuntu cosmic/main armhf libtasn1-6 armhf 4.13-3 [31.1 kB] Get:66 http://ftpmaster.internal/ubuntu cosmic/main armhf libncurses5 armhf 6.1+20180210-4ubuntu1 [74.9 kB] Get:67 http://ftpmaster.internal/ubuntu cosmic/main armhf libncursesw5 armhf 6.1+20180210-4ubuntu1 [95.3 kB] Get:68 http://ftpmaster.internal/ubuntu cosmic/main armhf libtinfo5 armhf 6.1+20180210-4ubuntu1 [67.6 kB] Get:69 http://ftpmaster.internal/ubuntu cosmic/main armhf readline-common all 7.0-5 [52.2 kB] Get:70 http://ftpmaster.internal/ubuntu cosmic/main armhf libreadline7 armhf 7.0-5 [102 kB] Get:71 http://ftpmaster.internal/ubuntu cosmic/main armhf libslang2 armhf 2.3.2-1ubuntu1 [383 kB] Get:72 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libsqlite3-0 armhf 3.24.0-1 [429 kB] Get:73 http://ftpmaster.internal/ubuntu cosmic/main armhf libssl1.1 armhf 1.1.0g-2ubuntu5 [912 kB] Get:74 http://ftpmaster.internal/ubuntu cosmic/main armhf openssl armhf 1.1.0g-2ubuntu5 [510 kB] Get:75 http://ftpmaster.internal/ubuntu cosmic/main armhf tzdata all 2018e-1 [188 kB] Get:76 http://ftpmaster.internal/ubuntu cosmic/main armhf libbinutils armhf 2.30-22ubuntu1 [309 kB] Get:77 http://ftpmaster.internal/ubuntu cosmic/main armhf binutils-common armhf 2.30-22ubuntu1 [193 kB] Get:78 http://ftpmaster.internal/ubuntu cosmic/main armhf binutils armhf 2.30-22ubuntu1 [3352 B] Get:79 http://ftpmaster.internal/ubuntu cosmic/main armhf binutils-arm-linux-gnueabihf armhf 2.30-22ubuntu1 [2175 kB] Get:80 http://ftpmaster.internal/ubuntu cosmic/main armhf libasan4 armhf 7.3.0-24ubuntu1 [328 kB] Get:81 http://ftpmaster.internal/ubuntu cosmic/main armhf libubsan0 armhf 7.3.0-24ubuntu1 [108 kB] Get:82 http://ftpmaster.internal/ubuntu cosmic/main armhf libcilkrts5 armhf 7.3.0-24ubuntu1 [35.9 kB] Get:83 http://ftpmaster.internal/ubuntu cosmic/main armhf g++-7 armhf 7.3.0-24ubuntu1 [6051 kB] Get:84 http://ftpmaster.internal/ubuntu cosmic/main armhf gcc-7 armhf 7.3.0-24ubuntu1 [5952 kB] Get:85 http://ftpmaster.internal/ubuntu cosmic/main armhf libstdc++-7-dev armhf 7.3.0-24ubuntu1 [1537 kB] Get:86 http://ftpmaster.internal/ubuntu cosmic/main armhf libgcc-7-dev armhf 7.3.0-24ubuntu1 [706 kB] Get:87 http://ftpmaster.internal/ubuntu cosmic/main armhf cpp-7 armhf 7.3.0-24ubuntu1 [5294 kB] Get:88 http://ftpmaster.internal/ubuntu cosmic/main armhf gcc-7-base armhf 7.3.0-24ubuntu1 [19.0 kB] Get:89 http://ftpmaster.internal/ubuntu cosmic/main armhf cpp armhf 4:7.3.0-3ubuntu3 [27.6 kB] Get:90 http://ftpmaster.internal/ubuntu cosmic/main armhf gcc armhf 4:7.3.0-3ubuntu3 [5228 B] Get:91 http://ftpmaster.internal/ubuntu cosmic/main armhf g++ armhf 4:7.3.0-3ubuntu3 [1600 B] Get:92 http://ftpmaster.internal/ubuntu cosmic/main armhf dpkg-dev all 1.19.0.5ubuntu3 [608 kB] Get:93 http://ftpmaster.internal/ubuntu cosmic/main armhf libdpkg-perl all 1.19.0.5ubuntu3 [211 kB] Get:94 http://ftpmaster.internal/ubuntu cosmic/main armhf build-essential armhf 12.5ubuntu2 [4732 B] Get:95 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf e2fslibs armhf 1.44.3~rc2-1 [2704 B] Get:96 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf pinentry-curses armhf 1.1.0-1build2 [31.4 kB] Get:97 http://ftpmaster.internal/ubuntu cosmic/main armhf libnpth0 armhf 1.5-4 [6648 B] Get:98 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf gpg armhf 2.2.8-1ubuntu1 [411 kB] Get:99 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf gpgconf armhf 2.2.8-1ubuntu1 [105 kB] Get:100 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf gpg-agent armhf 2.2.8-1ubuntu1 [189 kB] Get:101 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libcomerr2 armhf 1.44.3~rc2-1 [2700 B] Get:102 http://ftpmaster.internal/ubuntu cosmic/main armhf libusb-0.1-4 armhf 2:0.1.12-32 [15.6 kB] Get:103 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf linux-libc-dev armhf 4.17.0-4.5 [978 kB] Get:104 http://ftpmaster.internal/ubuntu cosmic/main armhf pkgbinarymangler all 139 [52.8 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 47.7 MB in 2s (25.1 MB/s) (Reading database ... 12378 files and directories currently installed.) Preparing to unpack .../base-files_10.1ubuntu4_armhf.deb ... Unpacking base-files (10.1ubuntu4) over (10.1ubuntu2) ... Setting up base-files (10.1ubuntu4) ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... Selecting previously unselected package libtinfo6:armhf. (Reading database ... 12378 files and directories currently installed.) Preparing to unpack .../libtinfo6_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libtinfo6:armhf (6.1+20180210-4ubuntu1) ... Setting up libtinfo6:armhf (6.1+20180210-4ubuntu1) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../debianutils_4.8.6_armhf.deb ... Unpacking debianutils (4.8.6) over (4.8.4) ... Setting up debianutils (4.8.6) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../bash_4.4.18-2ubuntu2_armhf.deb ... Unpacking bash (4.4.18-2ubuntu2) over (4.4.18-2ubuntu1) ... Setting up bash (4.4.18-2ubuntu2) ... update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../bsdutils_1%3a2.32-0.1ubuntu1_armhf.deb ... Unpacking bsdutils (1:2.32-0.1ubuntu1) over (1:2.31.1-0.4ubuntu3) ... Setting up bsdutils (1:2.32-0.1ubuntu1) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../tar_1.30+dfsg-2_armhf.deb ... Unpacking tar (1.30+dfsg-2) over (1.29b-2) ... Setting up tar (1.30+dfsg-2) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../dpkg_1.19.0.5ubuntu3_armhf.deb ... Unpacking dpkg (1.19.0.5ubuntu3) over (1.19.0.5ubuntu2) ... Setting up dpkg (1.19.0.5ubuntu3) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../libext2fs2_1.44.3~rc2-1_armhf.deb ... Unpacking libext2fs2:armhf (1.44.3~rc2-1) over (1.44.1-1) ... Setting up libext2fs2:armhf (1.44.3~rc2-1) ... (Reading database ... 12387 files and directories currently installed.) Preparing to unpack .../e2fsprogs_1.44.3~rc2-1_armhf.deb ... Unpacking e2fsprogs (1.44.3~rc2-1) over (1.44.1-1) ... Setting up e2fsprogs (1.44.3~rc2-1) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../ncurses-bin_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking ncurses-bin (6.1+20180210-4ubuntu1) over (6.1-1ubuntu1) ... Setting up ncurses-bin (6.1+20180210-4ubuntu1) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../perl_5.26.2-6_armhf.deb ... Unpacking perl (5.26.2-6) over (5.26.1-6) ... Preparing to unpack .../perl-modules-5.26_5.26.2-6_all.deb ... Unpacking perl-modules-5.26 (5.26.2-6) over (5.26.1-6) ... Preparing to unpack .../libperl5.26_5.26.2-6_armhf.deb ... Unpacking libperl5.26:armhf (5.26.2-6) over (5.26.1-6) ... Preparing to unpack .../perl-base_5.26.2-6_armhf.deb ... Unpacking perl-base (5.26.2-6) over (5.26.1-6) ... Setting up perl-base (5.26.2-6) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../archives/sed_4.5-1_armhf.deb ... Unpacking sed (4.5-1) over (4.4-2) ... Setting up sed (4.5-1) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../libuuid1_2.32-0.1ubuntu1_armhf.deb ... Unpacking libuuid1:armhf (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up libuuid1:armhf (2.32-0.1ubuntu1) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../libblkid1_2.32-0.1ubuntu1_armhf.deb ... Unpacking libblkid1:armhf (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up libblkid1:armhf (2.32-0.1ubuntu1) ... (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../libfdisk1_2.32-0.1ubuntu1_armhf.deb ... Unpacking libfdisk1:armhf (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up libfdisk1:armhf (2.32-0.1ubuntu1) ... Selecting previously unselected package libncursesw6:armhf. (Reading database ... 12389 files and directories currently installed.) Preparing to unpack .../libncursesw6_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libncursesw6:armhf (6.1+20180210-4ubuntu1) ... Setting up libncursesw6:armhf (6.1+20180210-4ubuntu1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../libselinux1_2.8-1build1_armhf.deb ... Unpacking libselinux1:armhf (2.8-1build1) over (2.7-2build2) ... Setting up libselinux1:armhf (2.8-1build1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../libmount1_2.32-0.1ubuntu1_armhf.deb ... Unpacking libmount1:armhf (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up libmount1:armhf (2.32-0.1ubuntu1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../libsmartcols1_2.32-0.1ubuntu1_armhf.deb ... Unpacking libsmartcols1:armhf (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up libsmartcols1:armhf (2.32-0.1ubuntu1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../fdisk_2.32-0.1ubuntu1_armhf.deb ... Unpacking fdisk (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up fdisk (2.32-0.1ubuntu1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../util-linux_2.32-0.1ubuntu1_armhf.deb ... Unpacking util-linux (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Setting up util-linux (2.32-0.1ubuntu1) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../base-passwd_3.5.45_armhf.deb ... Unpacking base-passwd (3.5.45) over (3.5.44) ... Setting up base-passwd (3.5.45) ... (Reading database ... 12398 files and directories currently installed.) Preparing to unpack .../ncurses-base_6.1+20180210-4ubuntu1_all.deb ... Unpacking ncurses-base (6.1+20180210-4ubuntu1) over (6.1-1ubuntu1) ... Setting up ncurses-base (6.1+20180210-4ubuntu1) ... (Reading database ... 12400 files and directories currently installed.) Preparing to unpack .../libgomp1_8.1.0-9ubuntu1_armhf.deb ... Unpacking libgomp1:armhf (8.1.0-9ubuntu1) over (8-20180414-1ubuntu2) ... Preparing to unpack .../gcc-8-base_8.1.0-9ubuntu1_armhf.deb ... Unpacking gcc-8-base:armhf (8.1.0-9ubuntu1) over (8-20180414-1ubuntu2) ... Setting up gcc-8-base:armhf (8.1.0-9ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libgcc1_1%3a8.1.0-9ubuntu1_armhf.deb ... Unpacking libgcc1:armhf (1:8.1.0-9ubuntu1) over (1:8-20180414-1ubuntu2) ... Setting up libgcc1:armhf (1:8.1.0-9ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libcc1-0_8.1.0-9ubuntu1_armhf.deb ... Unpacking libcc1-0:armhf (8.1.0-9ubuntu1) over (8-20180414-1ubuntu2) ... Preparing to unpack .../libatomic1_8.1.0-9ubuntu1_armhf.deb ... Unpacking libatomic1:armhf (8.1.0-9ubuntu1) over (8-20180414-1ubuntu2) ... Preparing to unpack .../libstdc++6_8.1.0-9ubuntu1_armhf.deb ... Unpacking libstdc++6:armhf (8.1.0-9ubuntu1) over (8-20180414-1ubuntu2) ... Setting up libstdc++6:armhf (8.1.0-9ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../liblz4-1_1.8.2-1ubuntu1_armhf.deb ... Unpacking liblz4-1:armhf (1.8.2-1ubuntu1) over (0.0~r131-2ubuntu3) ... Setting up liblz4-1:armhf (1.8.2-1ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libudev1_238-5ubuntu2_armhf.deb ... Unpacking libudev1:armhf (238-5ubuntu2) over (237-3ubuntu10) ... Setting up libudev1:armhf (238-5ubuntu2) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libapt-pkg5.0_1.7.0~alpha1_armhf.deb ... Unpacking libapt-pkg5.0:armhf (1.7.0~alpha1) over (1.6.1) ... Setting up libapt-pkg5.0:armhf (1.7.0~alpha1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../debconf_1.5.67_all.deb ... Unpacking debconf (1.5.67) over (1.5.66) ... Setting up debconf (1.5.67) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../adduser_3.117ubuntu1_all.deb ... Unpacking adduser (3.117ubuntu1) over (3.116ubuntu1) ... Setting up adduser (3.117ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libgpg-error0_1.31-1_armhf.deb ... Unpacking libgpg-error0:armhf (1.31-1) over (1.27-6) ... Setting up libgpg-error0:armhf (1.31-1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libgcrypt20_1.8.2-2ubuntu1_armhf.deb ... Unpacking libgcrypt20:armhf (1.8.2-2ubuntu1) over (1.8.1-4ubuntu1) ... Setting up libgcrypt20:armhf (1.8.2-2ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../gpgv_2.2.8-1ubuntu1_armhf.deb ... Unpacking gpgv (2.2.8-1ubuntu1) over (2.2.4-1ubuntu1) ... Setting up gpgv (2.2.8-1ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libseccomp2_2.3.3-3ubuntu1_armhf.deb ... Unpacking libseccomp2:armhf (2.3.3-3ubuntu1) over (2.3.1-2.1ubuntu4) ... Setting up libseccomp2:armhf (2.3.3-3ubuntu1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../apt_1.7.0~alpha1_armhf.deb ... Unpacking apt (1.7.0~alpha1) over (1.6.1) ... Setting up apt (1.7.0~alpha1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libapparmor1_2.12-4ubuntu6_armhf.deb ... Unpacking libapparmor1:armhf (2.12-4ubuntu6) over (2.12-4ubuntu5) ... Preparing to unpack .../libaudit-common_1%3a2.8.3-1ubuntu2_all.deb ... Unpacking libaudit-common (1:2.8.3-1ubuntu2) over (1:2.8.2-1ubuntu1) ... Setting up libaudit-common (1:2.8.3-1ubuntu2) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libcap-ng0_0.7.9-1_armhf.deb ... Unpacking libcap-ng0:armhf (0.7.9-1) over (0.7.7-3.1) ... Setting up libcap-ng0:armhf (0.7.9-1) ... (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a2.8.3-1ubuntu2_armhf.deb ... Unpacking libaudit1:armhf (1:2.8.3-1ubuntu2) over (1:2.8.2-1ubuntu1) ... Setting up libaudit1:armhf (1:2.8.3-1ubuntu2) ... Selecting previously unselected package libargon2-1:armhf. (Reading database ... 12399 files and directories currently installed.) Preparing to unpack .../0-libargon2-1_0~20171227-0.1_armhf.deb ... Unpacking libargon2-1:armhf (0~20171227-0.1) ... Preparing to unpack .../1-libargon2-0_0~20171227-0.1_armhf.deb ... Unpacking libargon2-0 (0~20171227-0.1) over (0~20161029-1.1) ... Preparing to unpack .../2-libcryptsetup12_2%3a2.0.2-1ubuntu2_armhf.deb ... Unpacking libcryptsetup12:armhf (2:2.0.2-1ubuntu2) over (2:2.0.2-1ubuntu1) ... Preparing to unpack .../3-libkmod2_25-1ubuntu1_armhf.deb ... Unpacking libkmod2:armhf (25-1ubuntu1) over (24-1ubuntu3) ... Preparing to unpack .../4-mount_2.32-0.1ubuntu1_armhf.deb ... Unpacking mount (2.32-0.1ubuntu1) over (2.31.1-0.4ubuntu3) ... Selecting previously unselected package libncurses6:armhf. Preparing to unpack .../5-libncurses6_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libncurses6:armhf (6.1+20180210-4ubuntu1) ... Selecting previously unselected package libprocps7:armhf. Preparing to unpack .../6-libprocps7_2%3a3.3.15-2ubuntu1_armhf.deb ... Unpacking libprocps7:armhf (2:3.3.15-2ubuntu1) ... Preparing to unpack .../7-procps_2%3a3.3.15-2ubuntu1_armhf.deb ... Unpacking procps (2:3.3.15-2ubuntu1) over (2:3.3.12-3ubuntu1) ... Setting up libargon2-1:armhf (0~20171227-0.1) ... Setting up libargon2-0 (0~20171227-0.1) ... Setting up libcryptsetup12:armhf (2:2.0.2-1ubuntu2) ... (Reading database ... 12421 files and directories currently installed.) Preparing to unpack .../systemd_238-5ubuntu2_armhf.deb ... Unpacking systemd (238-5ubuntu2) over (237-3ubuntu10) ... Preparing to unpack .../libsystemd0_238-5ubuntu2_armhf.deb ... Unpacking libsystemd0:armhf (238-5ubuntu2) over (237-3ubuntu10) ... Setting up libsystemd0:armhf (238-5ubuntu2) ... Setting up libapparmor1:armhf (2.12-4ubuntu6) ... Setting up libkmod2:armhf (25-1ubuntu1) ... Setting up mount (2.32-0.1ubuntu1) ... Setting up libncurses6:armhf (6.1+20180210-4ubuntu1) ... Setting up libprocps7:armhf (2:3.3.15-2ubuntu1) ... Setting up procps (2:3.3.15-2ubuntu1) ... Installing new version of config file /etc/init.d/procps ... Installing new version of config file /etc/sysctl.conf ... Installing new version of config file /etc/sysctl.d/10-network-security.conf ... Setting up systemd (238-5ubuntu2) ... Installing new version of config file /etc/systemd/logind.conf ... Installing new version of config file /etc/systemd/system.conf ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../systemd-sysv_238-5ubuntu2_armhf.deb ... Unpacking systemd-sysv (238-5ubuntu2) over (237-3ubuntu10) ... Preparing to unpack .../libcom-err2_1.44.3~rc2-1_armhf.deb ... Unpacking libcom-err2:armhf (1.44.3~rc2-1) over (1.44.1-1) ... Setting up libcom-err2:armhf (1.44.3~rc2-1) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libsepol1_2.8-1_armhf.deb ... Unpacking libsepol1:armhf (2.8-1) over (2.7-1) ... Setting up libsepol1:armhf (2.8-1) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libsemanage-common_2.8-1build1_all.deb ... Unpacking libsemanage-common (2.8-1build1) over (2.7-2build2) ... Setting up libsemanage-common (2.8-1build1) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libsemanage1_2.8-1build1_armhf.deb ... Unpacking libsemanage1:armhf (2.8-1build1) over (2.7-2build2) ... Setting up libsemanage1:armhf (2.8-1build1) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libss2_1.44.3~rc2-1_armhf.deb ... Unpacking libss2:armhf (1.44.3~rc2-1) over (1.44.1-1) ... Setting up libss2:armhf (1.44.3~rc2-1) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libgmp10_2%3a6.1.2+dfsg-3_armhf.deb ... Unpacking libgmp10:armhf (2:6.1.2+dfsg-3) over (2:6.1.2+dfsg-2) ... Setting up libgmp10:armhf (2:6.1.2+dfsg-3) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libp11-kit0_0.23.12-2_armhf.deb ... Unpacking libp11-kit0:armhf (0.23.12-2) over (0.23.9-2) ... Setting up libp11-kit0:armhf (0.23.12-2) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libtasn1-6_4.13-3_armhf.deb ... Unpacking libtasn1-6:armhf (4.13-3) over (4.13-2) ... Setting up libtasn1-6:armhf (4.13-3) ... (Reading database ... 12430 files and directories currently installed.) Preparing to unpack .../libncurses5_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libncurses5:armhf (6.1+20180210-4ubuntu1) over (6.1-1ubuntu1) ... Preparing to unpack .../libncursesw5_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libncursesw5:armhf (6.1+20180210-4ubuntu1) over (6.1-1ubuntu1) ... Preparing to unpack .../libtinfo5_6.1+20180210-4ubuntu1_armhf.deb ... Unpacking libtinfo5:armhf (6.1+20180210-4ubuntu1) over (6.1-1ubuntu1) ... Setting up libtinfo5:armhf (6.1+20180210-4ubuntu1) ... (Reading database ... 12428 files and directories currently installed.) Preparing to unpack .../00-readline-common_7.0-5_all.deb ... Unpacking readline-common (7.0-5) over (7.0-3) ... Preparing to unpack .../01-libreadline7_7.0-5_armhf.deb ... Unpacking libreadline7:armhf (7.0-5) over (7.0-3) ... Preparing to unpack .../02-libslang2_2.3.2-1ubuntu1_armhf.deb ... Unpacking libslang2:armhf (2.3.2-1ubuntu1) over (2.3.1a-3ubuntu1) ... Preparing to unpack .../03-libsqlite3-0_3.24.0-1_armhf.deb ... Unpacking libsqlite3-0:armhf (3.24.0-1) over (3.22.0-1) ... Preparing to unpack .../04-libssl1.1_1.1.0g-2ubuntu5_armhf.deb ... Unpacking libssl1.1:armhf (1.1.0g-2ubuntu5) over (1.1.0g-2ubuntu4) ... Preparing to unpack .../05-openssl_1.1.0g-2ubuntu5_armhf.deb ... Unpacking openssl (1.1.0g-2ubuntu5) over (1.1.0g-2ubuntu4) ... Preparing to unpack .../06-tzdata_2018e-1_all.deb ... Unpacking tzdata (2018e-1) over (2018d-1) ... Preparing to unpack .../07-libbinutils_2.30-22ubuntu1_armhf.deb ... Unpacking libbinutils:armhf (2.30-22ubuntu1) over (2.30-15ubuntu1) ... Preparing to unpack .../08-binutils-common_2.30-22ubuntu1_armhf.deb ... Unpacking binutils-common:armhf (2.30-22ubuntu1) over (2.30-15ubuntu1) ... Preparing to unpack .../09-binutils_2.30-22ubuntu1_armhf.deb ... Unpacking binutils (2.30-22ubuntu1) over (2.30-15ubuntu1) ... Preparing to unpack .../10-binutils-arm-linux-gnueabihf_2.30-22ubuntu1_armhf.deb ... Unpacking binutils-arm-linux-gnueabihf (2.30-22ubuntu1) over (2.30-15ubuntu1) ... Preparing to unpack .../11-libasan4_7.3.0-24ubuntu1_armhf.deb ... Unpacking libasan4:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../12-libubsan0_7.3.0-24ubuntu1_armhf.deb ... Unpacking libubsan0:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../13-libcilkrts5_7.3.0-24ubuntu1_armhf.deb ... Unpacking libcilkrts5:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../14-g++-7_7.3.0-24ubuntu1_armhf.deb ... Unpacking g++-7 (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../15-gcc-7_7.3.0-24ubuntu1_armhf.deb ... Unpacking gcc-7 (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../16-libstdc++-7-dev_7.3.0-24ubuntu1_armhf.deb ... Unpacking libstdc++-7-dev:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../17-libgcc-7-dev_7.3.0-24ubuntu1_armhf.deb ... Unpacking libgcc-7-dev:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../18-cpp-7_7.3.0-24ubuntu1_armhf.deb ... Unpacking cpp-7 (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../19-gcc-7-base_7.3.0-24ubuntu1_armhf.deb ... Unpacking gcc-7-base:armhf (7.3.0-24ubuntu1) over (7.3.0-16ubuntu3) ... Preparing to unpack .../20-cpp_4%3a7.3.0-3ubuntu3_armhf.deb ... Unpacking cpp (4:7.3.0-3ubuntu3) over (4:7.3.0-3ubuntu2) ... Preparing to unpack .../21-gcc_4%3a7.3.0-3ubuntu3_armhf.deb ... Unpacking gcc (4:7.3.0-3ubuntu3) over (4:7.3.0-3ubuntu2) ... Preparing to unpack .../22-g++_4%3a7.3.0-3ubuntu3_armhf.deb ... Unpacking g++ (4:7.3.0-3ubuntu3) over (4:7.3.0-3ubuntu2) ... Preparing to unpack .../23-dpkg-dev_1.19.0.5ubuntu3_all.deb ... Unpacking dpkg-dev (1.19.0.5ubuntu3) over (1.19.0.5ubuntu2) ... Preparing to unpack .../24-libdpkg-perl_1.19.0.5ubuntu3_all.deb ... Unpacking libdpkg-perl (1.19.0.5ubuntu3) over (1.19.0.5ubuntu2) ... Preparing to unpack .../25-build-essential_12.5ubuntu2_armhf.deb ... Unpacking build-essential (12.5ubuntu2) over (12.4ubuntu1) ... Preparing to unpack .../26-e2fslibs_1.44.3~rc2-1_armhf.deb ... Unpacking e2fslibs:armhf (1.44.3~rc2-1) over (1.44.1-1) ... Preparing to unpack .../27-pinentry-curses_1.1.0-1build2_armhf.deb ... Unpacking pinentry-curses (1.1.0-1build2) over (1.1.0-1) ... Preparing to unpack .../28-libnpth0_1.5-4_armhf.deb ... Unpacking libnpth0:armhf (1.5-4) over (1.5-3) ... Preparing to unpack .../29-gpg_2.2.8-1ubuntu1_armhf.deb ... Unpacking gpg (2.2.8-1ubuntu1) over (2.2.4-1ubuntu1) ... Preparing to unpack .../30-gpgconf_2.2.8-1ubuntu1_armhf.deb ... Unpacking gpgconf (2.2.8-1ubuntu1) over (2.2.4-1ubuntu1) ... Preparing to unpack .../31-gpg-agent_2.2.8-1ubuntu1_armhf.deb ... Unpacking gpg-agent (2.2.8-1ubuntu1) over (2.2.4-1ubuntu1) ... Preparing to unpack .../32-libcomerr2_1.44.3~rc2-1_armhf.deb ... Unpacking libcomerr2:armhf (1.44.3~rc2-1) over (1.44.1-1) ... Preparing to unpack .../33-libusb-0.1-4_2%3a0.1.12-32_armhf.deb ... Unpacking libusb-0.1-4:armhf (2:0.1.12-32) over (2:0.1.12-31) ... Preparing to unpack .../34-linux-libc-dev_4.17.0-4.5_armhf.deb ... Unpacking linux-libc-dev:armhf (4.17.0-4.5) over (4.15.0-20.21) ... Preparing to unpack .../35-pkgbinarymangler_139_all.deb ... Unpacking pkgbinarymangler (139) over (138) ... Setting up libnpth0:armhf (1.5-4) ... Setting up libncurses5:armhf (6.1+20180210-4ubuntu1) ... Setting up libgomp1:armhf (8.1.0-9ubuntu1) ... Setting up libatomic1:armhf (8.1.0-9ubuntu1) ... Setting up readline-common (7.0-5) ... Setting up libcc1-0:armhf (8.1.0-9ubuntu1) ... Setting up pkgbinarymangler (139) ... Setting up e2fslibs:armhf (1.44.3~rc2-1) ... Setting up libncursesw5:armhf (6.1+20180210-4ubuntu1) ... Setting up libreadline7:armhf (7.0-5) ... Setting up tzdata (2018e-1) ... Current default time zone: 'Etc/UTC' Local time is now: Mon Jul 9 11:16:56 UTC 2018. Universal Time is now: Mon Jul 9 11:16:56 UTC 2018. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up systemd-sysv (238-5ubuntu2) ... Setting up gpgconf (2.2.8-1ubuntu1) ... Setting up linux-libc-dev:armhf (4.17.0-4.5) ... Setting up perl-modules-5.26 (5.26.2-6) ... Setting up gcc-7-base:armhf (7.3.0-24ubuntu1) ... Setting up binutils-common:armhf (2.30-22ubuntu1) ... Processing triggers for libc-bin (2.27-3ubuntu1) ... Setting up libperl5.26:armhf (5.26.2-6) ... Setting up libssl1.1:armhf (1.1.0g-2ubuntu5) ... Setting up openssl (1.1.0g-2ubuntu5) ... Setting up libsqlite3-0:armhf (3.24.0-1) ... Setting up pinentry-curses (1.1.0-1build2) ... Setting up libcomerr2:armhf (1.44.3~rc2-1) ... Setting up libslang2:armhf (2.3.2-1ubuntu1) ... Setting up libusb-0.1-4:armhf (2:0.1.12-32) ... Setting up gpg (2.2.8-1ubuntu1) ... Setting up libasan4:armhf (7.3.0-24ubuntu1) ... Setting up libbinutils:armhf (2.30-22ubuntu1) ... Setting up libcilkrts5:armhf (7.3.0-24ubuntu1) ... Setting up libubsan0:armhf (7.3.0-24ubuntu1) ... Setting up binutils-arm-linux-gnueabihf (2.30-22ubuntu1) ... Setting up gpg-agent (2.2.8-1ubuntu1) ... Setting up libgcc-7-dev:armhf (7.3.0-24ubuntu1) ... Setting up cpp-7 (7.3.0-24ubuntu1) ... Setting up libstdc++-7-dev:armhf (7.3.0-24ubuntu1) ... Setting up perl (5.26.2-6) ... Setting up binutils (2.30-22ubuntu1) ... Setting up cpp (4:7.3.0-3ubuntu3) ... Setting up gcc-7 (7.3.0-24ubuntu1) ... Setting up g++-7 (7.3.0-24ubuntu1) ... Setting up libdpkg-perl (1.19.0.5ubuntu3) ... Setting up gcc (4:7.3.0-3ubuntu3) ... Setting up dpkg-dev (1.19.0.5ubuntu3) ... Setting up g++ (4:7.3.0-3ubuntu3) ... Setting up build-essential (12.5ubuntu2) ... Processing triggers for libc-bin (2.27-3ubuntu1) ... RUN: /usr/share/launchpad-buildd/slavebin/sbuild-package PACKAGEBUILD-15101291 armhf cosmic-proposed -c chroot:build-PACKAGEBUILD-15101291 --arch=armhf --dist=cosmic-proposed --nolog seqprep_1.3.2-3.dsc Initiating build PACKAGEBUILD-15101291 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 4.4.0-130-generic #156-Ubuntu SMP Thu Jun 14 08:52:48 UTC 2018 armv7l sbuild (Debian sbuild) 0.67.0 (26 Dec 2015) on bos02-arm64-018.buildd +==============================================================================+ | seqprep 1.3.2-3 (armhf) 09 Jul 2018 11:16 | +==============================================================================+ Package: seqprep Version: 1.3.2-3 Source Version: 1.3.2-3 Distribution: cosmic-proposed Machine Architecture: arm64 Host Architecture: armhf Build Architecture: armhf I: NOTICE: Log filtering will replace 'build/seqprep-aeLK9a/seqprep-1.3.2' with '<>' I: NOTICE: Log filtering will replace 'build/seqprep-aeLK9a' with '<>' I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-15101291/chroot-autobuild' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- seqprep_1.3.2-3.dsc exists in .; copying to chroot Check architectures ------------------- Check dependencies ------------------ Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<>/resolver-XioRF9/apt_archive/sbuild-build-depends-core-dummy.deb'. Ign:1 copy:/<>/resolver-XioRF9/apt_archive ./ InRelease Get:2 copy:/<>/resolver-XioRF9/apt_archive ./ Release [2119 B] Ign:3 copy:/<>/resolver-XioRF9/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-XioRF9/apt_archive ./ Sources [214 B] Get:5 copy:/<>/resolver-XioRF9/apt_archive ./ Packages [525 B] Fetched 2858 B in 0s (0 B/s) Reading package lists... Reading package lists... +------------------------------------------------------------------------------+ | Install core build dependencies (apt-based resolver) | +------------------------------------------------------------------------------+ Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: libncursesw5 libprocps6 Use 'apt autoremove' to remove them. The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 852 B of archives. After this operation, 0 B of additional disk space will be used. Get:1 copy:/<>/resolver-XioRF9/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [852 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 852 B in 0s (0 B/s) Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... 12442 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... Merged Build-Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev Filtered Build-Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<>/resolver-r_n2Gu/apt_archive/sbuild-build-depends-seqprep-dummy.deb'. Ign:1 copy:/<>/resolver-r_n2Gu/apt_archive ./ InRelease Get:2 copy:/<>/resolver-r_n2Gu/apt_archive ./ Release [2119 B] Ign:3 copy:/<>/resolver-r_n2Gu/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-r_n2Gu/apt_archive ./ Sources [237 B] Get:5 copy:/<>/resolver-r_n2Gu/apt_archive ./ Packages [556 B] Fetched 2912 B in 49710d 6h 28min 15s (0 B/s) Reading package lists... Reading package lists... +------------------------------------------------------------------------------+ | Install seqprep build dependencies (apt-based resolver) | +------------------------------------------------------------------------------+ Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: libncursesw5 libprocps6 Use 'apt autoremove' to remove them. The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdmainutils debhelper dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3 libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libice6 libicu60 libmagic-mgc libmagic1 libpipeline1 libpython-stdlib libpython2-stdlib libpython2.7-minimal libpython2.7-stdlib libruby2.5 libsigsegv2 libsm6 libtimedate-perl libtool libx11-6 libx11-data libxau6 libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6 libyaml-0-2 m4 man-db mime-support po-debconf python python-markdown python-minimal python2 python2-minimal python2.7 python2.7-minimal rake ronn ruby ruby-did-you-mean ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.5 rubygems-integration x11-common zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois vacation dh-make gettext-doc libasprintf-dev libgettextpo-dev libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libmail-box-perl python-doc python-tk python-markdown-doc python2-doc python2.7-doc binfmt-support ri ruby-dev bundler Recommended packages: curl | wget | lynx ghostscript imagemagick libpaper1 netpbm psutils libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs libltdl-dev libmail-sendmail-perl python-pygments python-yaml zip fonts-lato libjs-jquery The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdmainutils debhelper dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3 libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libice6 libicu60 libmagic-mgc libmagic1 libpipeline1 libpython-stdlib libpython2-stdlib libpython2.7-minimal libpython2.7-stdlib libruby2.5 libsigsegv2 libsm6 libtimedate-perl libtool libx11-6 libx11-data libxau6 libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6 libyaml-0-2 m4 man-db mime-support po-debconf python python-markdown python-minimal python2 python2-minimal python2.7 python2.7-minimal rake ronn ruby ruby-did-you-mean ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.5 rubygems-integration sbuild-build-depends-seqprep-dummy x11-common zlib1g-dev 0 upgraded, 77 newly installed, 0 to remove and 0 not upgraded. Need to get 27.3 MB of archives. After this operation, 101 MB of additional disk space will be used. Get:1 copy:/<>/resolver-r_n2Gu/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [884 B] Get:2 http://ftpmaster.internal/ubuntu cosmic/main armhf libxau6 armhf 1:1.0.8-1 [7324 B] Get:3 http://ftpmaster.internal/ubuntu cosmic/main armhf libbsd0 armhf 0.9.1-1 [43.1 kB] Get:4 http://ftpmaster.internal/ubuntu cosmic/main armhf libxdmcp6 armhf 1:1.1.2-3 [9316 B] Get:5 http://ftpmaster.internal/ubuntu cosmic/main armhf libxcb1 armhf 1.13-1 [41.2 kB] Get:6 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libx11-data all 2:1.6.5-1 [113 kB] Get:7 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libx11-6 armhf 2:1.6.5-1 [514 kB] Get:8 http://ftpmaster.internal/ubuntu cosmic/main armhf libxext6 armhf 2:1.3.3-1 [25.1 kB] Get:9 http://ftpmaster.internal/ubuntu cosmic/main armhf bsdmainutils armhf 11.1.2ubuntu2 [176 kB] Get:10 http://ftpmaster.internal/ubuntu cosmic/main armhf groff-base armhf 1.22.3-10 [1013 kB] Get:11 http://ftpmaster.internal/ubuntu cosmic/main armhf libpipeline1 armhf 1.5.0-1 [21.1 kB] Get:12 http://ftpmaster.internal/ubuntu cosmic/main armhf man-db armhf 2.8.3-2 [993 kB] Get:13 http://ftpmaster.internal/ubuntu cosmic/main armhf x11-common all 1:7.7+19ubuntu8 [22.5 kB] Get:14 http://ftpmaster.internal/ubuntu cosmic/main armhf libice6 armhf 2:1.0.9-2 [33.5 kB] Get:15 http://ftpmaster.internal/ubuntu cosmic/main armhf libsm6 armhf 2:1.2.2-1 [13.9 kB] Get:16 http://ftpmaster.internal/ubuntu cosmic/main armhf libpython2.7-minimal armhf 2.7.15-1 [334 kB] Get:17 http://ftpmaster.internal/ubuntu cosmic/main armhf python2.7-minimal armhf 2.7.15-1 [1083 kB] Get:18 http://ftpmaster.internal/ubuntu cosmic/main armhf python2-minimal armhf 2.7.15-3 [28.1 kB] Get:19 http://ftpmaster.internal/ubuntu cosmic/main armhf python-minimal armhf 2.7.15-3 [5996 B] Get:20 http://ftpmaster.internal/ubuntu cosmic/main armhf mime-support all 3.60ubuntu1 [30.1 kB] Get:21 http://ftpmaster.internal/ubuntu cosmic/main armhf libexpat1 armhf 2.2.5-3 [59.7 kB] Get:22 http://ftpmaster.internal/ubuntu cosmic/main armhf libpython2.7-stdlib armhf 2.7.15-1 [1833 kB] Get:23 http://ftpmaster.internal/ubuntu cosmic/main armhf python2.7 armhf 2.7.15-1 [239 kB] Get:24 http://ftpmaster.internal/ubuntu cosmic/main armhf libpython2-stdlib armhf 2.7.15-3 [7728 B] Get:25 http://ftpmaster.internal/ubuntu cosmic/main armhf libpython-stdlib armhf 2.7.15-3 [5824 B] Get:26 http://ftpmaster.internal/ubuntu cosmic/main armhf python2 armhf 2.7.15-3 [26.5 kB] Get:27 http://ftpmaster.internal/ubuntu cosmic/main armhf python armhf 2.7.15-3 [7828 B] Get:28 http://ftpmaster.internal/ubuntu cosmic/main armhf libmagic-mgc armhf 1:5.33-3 [192 kB] Get:29 http://ftpmaster.internal/ubuntu cosmic/main armhf libmagic1 armhf 1:5.33-3 [63.7 kB] Get:30 http://ftpmaster.internal/ubuntu cosmic/main armhf file armhf 1:5.33-3 [22.1 kB] Get:31 http://ftpmaster.internal/ubuntu cosmic/main armhf libelf1 armhf 0.170-0.5 [42.2 kB] Get:32 http://ftpmaster.internal/ubuntu cosmic/main armhf libglib2.0-0 armhf 2.56.1-2ubuntu1 [1014 kB] Get:33 http://ftpmaster.internal/ubuntu cosmic/main armhf libicu60 armhf 60.2-6ubuntu1 [7801 kB] Get:34 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf libxml2 armhf 2.9.4+dfsg1-7build1 [568 kB] Get:35 http://ftpmaster.internal/ubuntu cosmic/main armhf libyaml-0-2 armhf 0.2.1-1 [40.1 kB] Get:36 http://ftpmaster.internal/ubuntu cosmic/main armhf gettext-base armhf 0.19.8.1-6build1 [46.2 kB] Get:37 http://ftpmaster.internal/ubuntu cosmic/main armhf libsigsegv2 armhf 2.12-2 [13.1 kB] Get:38 http://ftpmaster.internal/ubuntu cosmic/main armhf m4 armhf 1.4.18-1 [181 kB] Get:39 http://ftpmaster.internal/ubuntu cosmic/main armhf autoconf all 2.69-11 [322 kB] Get:40 http://ftpmaster.internal/ubuntu cosmic/main armhf autotools-dev all 20180224.1 [39.6 kB] Get:41 http://ftpmaster.internal/ubuntu cosmic/main armhf automake all 1:1.15.1-3ubuntu2 [509 kB] Get:42 http://ftpmaster.internal/ubuntu cosmic/main armhf autopoint all 0.19.8.1-6build1 [412 kB] Get:43 http://ftpmaster.internal/ubuntu cosmic/main armhf libtool all 2.4.6-2.1 [195 kB] Get:44 http://ftpmaster.internal/ubuntu cosmic/main armhf dh-autoreconf all 19 [16.1 kB] Get:45 http://ftpmaster.internal/ubuntu cosmic/main armhf libarchive-zip-perl all 1.60-1 [83.9 kB] Get:46 http://ftpmaster.internal/ubuntu cosmic/main armhf libfile-stripnondeterminism-perl all 0.042-1 [15.2 kB] Get:47 http://ftpmaster.internal/ubuntu cosmic/main armhf libtimedate-perl all 2.3000-2 [37.5 kB] Get:48 http://ftpmaster.internal/ubuntu cosmic/main armhf dh-strip-nondeterminism all 0.042-1 [5188 B] Get:49 http://ftpmaster.internal/ubuntu cosmic/main armhf dwz armhf 0.12-2 [72.0 kB] Get:50 http://ftpmaster.internal/ubuntu cosmic/main armhf libcroco3 armhf 0.6.12-2 [69.4 kB] Get:51 http://ftpmaster.internal/ubuntu cosmic/main armhf gettext armhf 0.19.8.1-6build1 [834 kB] Get:52 http://ftpmaster.internal/ubuntu cosmic/main armhf intltool-debian all 0.35.0+20060710.4 [24.9 kB] Get:53 http://ftpmaster.internal/ubuntu cosmic/main armhf po-debconf all 1.0.20 [232 kB] Get:54 http://ftpmaster.internal/ubuntu cosmic/main armhf debhelper all 11.3.2ubuntu1 [883 kB] Get:55 http://ftpmaster.internal/ubuntu cosmic/main armhf libxt6 armhf 1:1.1.5-1 [129 kB] Get:56 http://ftpmaster.internal/ubuntu cosmic/main armhf libxmu6 armhf 2:1.1.2-2 [38.3 kB] Get:57 http://ftpmaster.internal/ubuntu cosmic/main armhf libxpm4 armhf 1:3.5.12-1 [29.0 kB] Get:58 http://ftpmaster.internal/ubuntu cosmic/main armhf libxaw7 armhf 2:1.0.13-1 [141 kB] Get:59 http://ftpmaster.internal/ubuntu cosmic/universe armhf groff armhf 1.22.3-10 [3083 kB] Get:60 http://ftpmaster.internal/ubuntu cosmic/main armhf rubygems-integration all 1.11 [4994 B] Get:61 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby2.5 armhf 2.5.1-1ubuntu1 [48.5 kB] Get:62 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby armhf 1:2.5.1 [5712 B] Get:63 http://ftpmaster.internal/ubuntu cosmic/main armhf rake all 12.3.1-3 [44.9 kB] Get:64 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby-did-you-mean all 1.2.1-1 [9828 B] Get:65 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby-minitest all 5.10.3-1 [38.6 kB] Get:66 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby-net-telnet all 0.1.1-2 [12.6 kB] Get:67 http://ftpmaster.internal/ubuntu cosmic/main armhf ruby-power-assert all 1.1.1-1 [11.0 kB] Get:68 http://ftpmaster.internal/ubuntu cosmic-proposed/main armhf ruby-test-unit all 3.2.7-1 [61.4 kB] Get:69 http://ftpmaster.internal/ubuntu cosmic/main armhf libruby2.5 armhf 2.5.1-1ubuntu1 [2836 kB] Get:70 http://ftpmaster.internal/ubuntu cosmic/universe armhf python-markdown all 2.6.9-1 [55.1 kB] Get:71 http://ftpmaster.internal/ubuntu cosmic/universe armhf ruby-fast-xs armhf 0.8.0-3build10 [8540 B] Get:72 http://ftpmaster.internal/ubuntu cosmic/universe armhf ruby-hpricot armhf 0.8.6-6ubuntu3 [61.4 kB] Get:73 http://ftpmaster.internal/ubuntu cosmic/universe armhf ruby-mustache all 1.0.2-1 [25.3 kB] Get:74 http://ftpmaster.internal/ubuntu cosmic/universe armhf ruby-rdiscount armhf 2.1.8-1build5 [32.7 kB] Get:75 http://ftpmaster.internal/ubuntu cosmic/universe armhf ruby-ronn all 0.7.3-5.1 [20.8 kB] Get:76 http://ftpmaster.internal/ubuntu cosmic/universe armhf ronn all 0.7.3-5.1 [7960 B] Get:77 http://ftpmaster.internal/ubuntu cosmic/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-0ubuntu2 [168 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 27.3 MB in 0s (0 B/s) Selecting previously unselected package libxau6:armhf. (Reading database ... 12442 files and directories currently installed.) Preparing to unpack .../00-libxau6_1%3a1.0.8-1_armhf.deb ... Unpacking libxau6:armhf (1:1.0.8-1) ... Selecting previously unselected package libbsd0:armhf. Preparing to unpack .../01-libbsd0_0.9.1-1_armhf.deb ... Unpacking libbsd0:armhf (0.9.1-1) ... Selecting previously unselected package libxdmcp6:armhf. Preparing to unpack .../02-libxdmcp6_1%3a1.1.2-3_armhf.deb ... Unpacking libxdmcp6:armhf (1:1.1.2-3) ... Selecting previously unselected package libxcb1:armhf. Preparing to unpack .../03-libxcb1_1.13-1_armhf.deb ... Unpacking libxcb1:armhf (1.13-1) ... Selecting previously unselected package libx11-data. Preparing to unpack .../04-libx11-data_2%3a1.6.5-1_all.deb ... Unpacking libx11-data (2:1.6.5-1) ... Selecting previously unselected package libx11-6:armhf. Preparing to unpack .../05-libx11-6_2%3a1.6.5-1_armhf.deb ... Unpacking libx11-6:armhf (2:1.6.5-1) ... Selecting previously unselected package libxext6:armhf. Preparing to unpack .../06-libxext6_2%3a1.3.3-1_armhf.deb ... Unpacking libxext6:armhf (2:1.3.3-1) ... Selecting previously unselected package bsdmainutils. Preparing to unpack .../07-bsdmainutils_11.1.2ubuntu2_armhf.deb ... Unpacking bsdmainutils (11.1.2ubuntu2) ... Selecting previously unselected package groff-base. Preparing to unpack .../08-groff-base_1.22.3-10_armhf.deb ... Unpacking groff-base (1.22.3-10) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../09-libpipeline1_1.5.0-1_armhf.deb ... Unpacking libpipeline1:armhf (1.5.0-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.8.3-2_armhf.deb ... Unpacking man-db (2.8.3-2) ... Selecting previously unselected package x11-common. Preparing to unpack .../11-x11-common_1%3a7.7+19ubuntu8_all.deb ... dpkg-query: no packages found matching nux-tools Unpacking x11-common (1:7.7+19ubuntu8) ... Selecting previously unselected package libice6:armhf. Preparing to unpack .../12-libice6_2%3a1.0.9-2_armhf.deb ... Unpacking libice6:armhf (2:1.0.9-2) ... Selecting previously unselected package libsm6:armhf. Preparing to unpack .../13-libsm6_2%3a1.2.2-1_armhf.deb ... Unpacking libsm6:armhf (2:1.2.2-1) ... Selecting previously unselected package libpython2.7-minimal:armhf. Preparing to unpack .../14-libpython2.7-minimal_2.7.15-1_armhf.deb ... Unpacking libpython2.7-minimal:armhf (2.7.15-1) ... Selecting previously unselected package python2.7-minimal. Preparing to unpack .../15-python2.7-minimal_2.7.15-1_armhf.deb ... Unpacking python2.7-minimal (2.7.15-1) ... Selecting previously unselected package python2-minimal. Preparing to unpack .../16-python2-minimal_2.7.15-3_armhf.deb ... Unpacking python2-minimal (2.7.15-3) ... Selecting previously unselected package python-minimal. Preparing to unpack .../17-python-minimal_2.7.15-3_armhf.deb ... Unpacking python-minimal (2.7.15-3) ... Selecting previously unselected package mime-support. Preparing to unpack .../18-mime-support_3.60ubuntu1_all.deb ... Unpacking mime-support (3.60ubuntu1) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../19-libexpat1_2.2.5-3_armhf.deb ... Unpacking libexpat1:armhf (2.2.5-3) ... Selecting previously unselected package libpython2.7-stdlib:armhf. Preparing to unpack .../20-libpython2.7-stdlib_2.7.15-1_armhf.deb ... Unpacking libpython2.7-stdlib:armhf (2.7.15-1) ... Selecting previously unselected package python2.7. Preparing to unpack .../21-python2.7_2.7.15-1_armhf.deb ... Unpacking python2.7 (2.7.15-1) ... Selecting previously unselected package libpython2-stdlib:armhf. Preparing to unpack .../22-libpython2-stdlib_2.7.15-3_armhf.deb ... Unpacking libpython2-stdlib:armhf (2.7.15-3) ... Selecting previously unselected package libpython-stdlib:armhf. Preparing to unpack .../23-libpython-stdlib_2.7.15-3_armhf.deb ... Unpacking libpython-stdlib:armhf (2.7.15-3) ... Setting up libpython2.7-minimal:armhf (2.7.15-1) ... Setting up python2.7-minimal (2.7.15-1) ... Setting up python2-minimal (2.7.15-3) ... Selecting previously unselected package python2. (Reading database ... 14110 files and directories currently installed.) Preparing to unpack .../python2_2.7.15-3_armhf.deb ... Unpacking python2 (2.7.15-3) ... Setting up python-minimal (2.7.15-3) ... Selecting previously unselected package python. (Reading database ... 14143 files and directories currently installed.) Preparing to unpack .../00-python_2.7.15-3_armhf.deb ... Unpacking python (2.7.15-3) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../01-libmagic-mgc_1%3a5.33-3_armhf.deb ... Unpacking libmagic-mgc (1:5.33-3) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../02-libmagic1_1%3a5.33-3_armhf.deb ... Unpacking libmagic1:armhf (1:5.33-3) ... Selecting previously unselected package file. Preparing to unpack .../03-file_1%3a5.33-3_armhf.deb ... Unpacking file (1:5.33-3) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../04-libelf1_0.170-0.5_armhf.deb ... Unpacking libelf1:armhf (0.170-0.5) ... Selecting previously unselected package libglib2.0-0:armhf. Preparing to unpack .../05-libglib2.0-0_2.56.1-2ubuntu1_armhf.deb ... Unpacking libglib2.0-0:armhf (2.56.1-2ubuntu1) ... Selecting previously unselected package libicu60:armhf. Preparing to unpack .../06-libicu60_60.2-6ubuntu1_armhf.deb ... Unpacking libicu60:armhf (60.2-6ubuntu1) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../07-libxml2_2.9.4+dfsg1-7build1_armhf.deb ... Unpacking libxml2:armhf (2.9.4+dfsg1-7build1) ... Selecting previously unselected package libyaml-0-2:armhf. Preparing to unpack .../08-libyaml-0-2_0.2.1-1_armhf.deb ... Unpacking libyaml-0-2:armhf (0.2.1-1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../09-gettext-base_0.19.8.1-6build1_armhf.deb ... Unpacking gettext-base (0.19.8.1-6build1) ... Selecting previously unselected package libsigsegv2:armhf. Preparing to unpack .../10-libsigsegv2_2.12-2_armhf.deb ... Unpacking libsigsegv2:armhf (2.12-2) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.18-1_armhf.deb ... Unpacking m4 (1.4.18-1) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.69-11_all.deb ... Unpacking autoconf (2.69-11) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.15.1-3ubuntu2_all.deb ... Unpacking automake (1:1.15.1-3ubuntu2) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.19.8.1-6build1_all.deb ... Unpacking autopoint (0.19.8.1-6build1) ... Selecting previously unselected package libtool. Preparing to unpack .../16-libtool_2.4.6-2.1_all.deb ... Unpacking libtool (2.4.6-2.1) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../17-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../18-libarchive-zip-perl_1.60-1_all.deb ... Unpacking libarchive-zip-perl (1.60-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../19-libfile-stripnondeterminism-perl_0.042-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (0.042-1) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../20-libtimedate-perl_2.3000-2_all.deb ... Unpacking libtimedate-perl (2.3000-2) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_0.042-1_all.deb ... Unpacking dh-strip-nondeterminism (0.042-1) ... Selecting previously unselected package dwz. Preparing to unpack .../22-dwz_0.12-2_armhf.deb ... Unpacking dwz (0.12-2) ... Selecting previously unselected package libcroco3:armhf. Preparing to unpack .../23-libcroco3_0.6.12-2_armhf.deb ... Unpacking libcroco3:armhf (0.6.12-2) ... Selecting previously unselected package gettext. Preparing to unpack .../24-gettext_0.19.8.1-6build1_armhf.deb ... Unpacking gettext (0.19.8.1-6build1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../25-intltool-debian_0.35.0+20060710.4_all.deb ... Unpacking intltool-debian (0.35.0+20060710.4) ... Selecting previously unselected package po-debconf. Preparing to unpack .../26-po-debconf_1.0.20_all.deb ... Unpacking po-debconf (1.0.20) ... Selecting previously unselected package debhelper. Preparing to unpack .../27-debhelper_11.3.2ubuntu1_all.deb ... Unpacking debhelper (11.3.2ubuntu1) ... Selecting previously unselected package libxt6:armhf. Preparing to unpack .../28-libxt6_1%3a1.1.5-1_armhf.deb ... Unpacking libxt6:armhf (1:1.1.5-1) ... Selecting previously unselected package libxmu6:armhf. Preparing to unpack .../29-libxmu6_2%3a1.1.2-2_armhf.deb ... Unpacking libxmu6:armhf (2:1.1.2-2) ... Selecting previously unselected package libxpm4:armhf. Preparing to unpack .../30-libxpm4_1%3a3.5.12-1_armhf.deb ... Unpacking libxpm4:armhf (1:3.5.12-1) ... Selecting previously unselected package libxaw7:armhf. Preparing to unpack .../31-libxaw7_2%3a1.0.13-1_armhf.deb ... Unpacking libxaw7:armhf (2:1.0.13-1) ... Selecting previously unselected package groff. Preparing to unpack .../32-groff_1.22.3-10_armhf.deb ... Unpacking groff (1.22.3-10) ... Selecting previously unselected package rubygems-integration. Preparing to unpack .../33-rubygems-integration_1.11_all.deb ... Unpacking rubygems-integration (1.11) ... Selecting previously unselected package ruby2.5. Preparing to unpack .../34-ruby2.5_2.5.1-1ubuntu1_armhf.deb ... Unpacking ruby2.5 (2.5.1-1ubuntu1) ... Selecting previously unselected package ruby. Preparing to unpack .../35-ruby_1%3a2.5.1_armhf.deb ... Unpacking ruby (1:2.5.1) ... Selecting previously unselected package rake. Preparing to unpack .../36-rake_12.3.1-3_all.deb ... Unpacking rake (12.3.1-3) ... Selecting previously unselected package ruby-did-you-mean. Preparing to unpack .../37-ruby-did-you-mean_1.2.1-1_all.deb ... Unpacking ruby-did-you-mean (1.2.1-1) ... Selecting previously unselected package ruby-minitest. Preparing to unpack .../38-ruby-minitest_5.10.3-1_all.deb ... Unpacking ruby-minitest (5.10.3-1) ... Selecting previously unselected package ruby-net-telnet. Preparing to unpack .../39-ruby-net-telnet_0.1.1-2_all.deb ... Unpacking ruby-net-telnet (0.1.1-2) ... Selecting previously unselected package ruby-power-assert. Preparing to unpack .../40-ruby-power-assert_1.1.1-1_all.deb ... Unpacking ruby-power-assert (1.1.1-1) ... Selecting previously unselected package ruby-test-unit. Preparing to unpack .../41-ruby-test-unit_3.2.7-1_all.deb ... Unpacking ruby-test-unit (3.2.7-1) ... Selecting previously unselected package libruby2.5:armhf. Preparing to unpack .../42-libruby2.5_2.5.1-1ubuntu1_armhf.deb ... Unpacking libruby2.5:armhf (2.5.1-1ubuntu1) ... Selecting previously unselected package python-markdown. Preparing to unpack .../43-python-markdown_2.6.9-1_all.deb ... Unpacking python-markdown (2.6.9-1) ... Selecting previously unselected package ruby-fast-xs. Preparing to unpack .../44-ruby-fast-xs_0.8.0-3build10_armhf.deb ... Unpacking ruby-fast-xs (0.8.0-3build10) ... Selecting previously unselected package ruby-hpricot. Preparing to unpack .../45-ruby-hpricot_0.8.6-6ubuntu3_armhf.deb ... Unpacking ruby-hpricot (0.8.6-6ubuntu3) ... Selecting previously unselected package ruby-mustache. Preparing to unpack .../46-ruby-mustache_1.0.2-1_all.deb ... Unpacking ruby-mustache (1.0.2-1) ... Selecting previously unselected package ruby-rdiscount. Preparing to unpack .../47-ruby-rdiscount_2.1.8-1build5_armhf.deb ... Unpacking ruby-rdiscount (2.1.8-1build5) ... Selecting previously unselected package ruby-ronn. Preparing to unpack .../48-ruby-ronn_0.7.3-5.1_all.deb ... Unpacking ruby-ronn (0.7.3-5.1) ... Selecting previously unselected package ronn. Preparing to unpack .../49-ronn_0.7.3-5.1_all.deb ... Unpacking ronn (0.7.3-5.1) ... Selecting previously unselected package zlib1g-dev:armhf. Preparing to unpack .../50-zlib1g-dev_1%3a1.2.11.dfsg-0ubuntu2_armhf.deb ... Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-0ubuntu2) ... Selecting previously unselected package sbuild-build-depends-seqprep-dummy. Preparing to unpack .../51-sbuild-build-depends-seqprep-dummy_0.invalid.0_armhf.deb ... Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ... Setting up libexpat1:armhf (2.2.5-3) ... Setting up libicu60:armhf (60.2-6ubuntu1) ... Setting up libarchive-zip-perl (1.60-1) ... Setting up mime-support (3.60ubuntu1) ... Setting up libtimedate-perl (2.3000-2) ... Setting up libsigsegv2:armhf (2.12-2) ... Setting up libelf1:armhf (0.170-0.5) ... Setting up groff-base (1.22.3-10) ... Setting up libglib2.0-0:armhf (2.56.1-2ubuntu1) ... No schema files found: doing nothing. Setting up gettext-base (0.19.8.1-6build1) ... Setting up libpipeline1:armhf (1.5.0-1) ... Setting up m4 (1.4.18-1) ... Setting up libbsd0:armhf (0.9.1-1) ... Setting up libxml2:armhf (2.9.4+dfsg1-7build1) ... Setting up libmagic-mgc (1:5.33-3) ... Setting up libmagic1:armhf (1:5.33-3) ... Setting up libcroco3:armhf (0.6.12-2) ... Setting up ruby-did-you-mean (1.2.1-1) ... Setting up libyaml-0-2:armhf (0.2.1-1) ... Processing triggers for libc-bin (2.27-3ubuntu1) ... Setting up dwz (0.12-2) ... Setting up autotools-dev (20180224.1) ... Processing triggers for systemd (238-5ubuntu2) ... Setting up ruby-net-telnet (0.1.1-2) ... Setting up rubygems-integration (1.11) ... Setting up libxdmcp6:armhf (1:1.1.2-3) ... Setting up bsdmainutils (11.1.2ubuntu2) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up ruby-minitest (5.10.3-1) ... Setting up x11-common (1:7.7+19ubuntu8) ... update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Setting up libx11-data (2:1.6.5-1) ... Setting up libpython2.7-stdlib:armhf (2.7.15-1) ... Setting up libxau6:armhf (1:1.0.8-1) ... Setting up autopoint (0.19.8.1-6build1) ... Setting up ruby-power-assert (1.1.1-1) ... Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-0ubuntu2) ... Setting up libfile-stripnondeterminism-perl (0.042-1) ... Setting up ruby-test-unit (3.2.7-1) ... Setting up gettext (0.19.8.1-6build1) ... Setting up python2.7 (2.7.15-1) ... Setting up autoconf (2.69-11) ... Setting up file (1:5.33-3) ... Setting up intltool-debian (0.35.0+20060710.4) ... Setting up automake (1:1.15.1-3ubuntu2) ... update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode Setting up libice6:armhf (2:1.0.9-2) ... Setting up man-db (2.8.3-2) ... Not building database; man-db/auto-update is not 'true'. Setting up libpython2-stdlib:armhf (2.7.15-3) ... Setting up libxcb1:armhf (1.13-1) ... Setting up libtool (2.4.6-2.1) ... Setting up libsm6:armhf (2:1.2.2-1) ... Setting up po-debconf (1.0.20) ... Setting up libx11-6:armhf (2:1.6.5-1) ... Setting up python2 (2.7.15-3) ... Setting up libpython-stdlib:armhf (2.7.15-3) ... Setting up libxpm4:armhf (1:3.5.12-1) ... Setting up libxt6:armhf (1:1.1.5-1) ... Setting up python (2.7.15-3) ... Setting up python-markdown (2.6.9-1) ... Setting up libxext6:armhf (2:1.3.3-1) ... Setting up libxmu6:armhf (2:1.1.2-2) ... Setting up libxaw7:armhf (2:1.0.13-1) ... Setting up groff (1.22.3-10) ... Setting up ruby2.5 (2.5.1-1ubuntu1) ... Setting up dh-autoreconf (19) ... Setting up dh-strip-nondeterminism (0.042-1) ... Setting up ruby (1:2.5.1) ... Setting up debhelper (11.3.2ubuntu1) ... Setting up ruby-mustache (1.0.2-1) ... Setting up rake (12.3.1-3) ... Setting up libruby2.5:armhf (2.5.1-1ubuntu1) ... Setting up ruby-fast-xs (0.8.0-3build10) ... Setting up ruby-hpricot (0.8.6-6ubuntu3) ... Setting up ruby-rdiscount (2.1.8-1build5) ... Setting up ruby-ronn (0.7.3-5.1) ... Setting up ronn (0.7.3-5.1) ... Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.27-3ubuntu1) ... Processing triggers for systemd (238-5ubuntu2) ... +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 4.4.0-130-generic arm64 (armv7l) Toolchain package versions: binutils_2.30-22ubuntu1 dpkg-dev_1.19.0.5ubuntu3 g++-7_7.3.0-24ubuntu1 gcc-7_7.3.0-24ubuntu1 libc6-dev_2.27-3ubuntu1 libstdc++-7-dev_7.3.0-24ubuntu1 libstdc++6_8.1.0-9ubuntu1 linux-libc-dev_4.17.0-4.5 Package versions: adduser_3.117ubuntu1 advancecomp_2.1-1 apt_1.7.0~alpha1 autoconf_2.69-11 automake_1:1.15.1-3ubuntu2 autopoint_0.19.8.1-6build1 autotools-dev_20180224.1 base-files_10.1ubuntu4 base-passwd_3.5.45 bash_4.4.18-2ubuntu2 binutils_2.30-22ubuntu1 binutils-arm-linux-gnueabihf_2.30-22ubuntu1 binutils-common_2.30-22ubuntu1 bsdmainutils_11.1.2ubuntu2 bsdutils_1:2.32-0.1ubuntu1 build-essential_12.5ubuntu2 bzip2_1.0.6-8.1 ca-certificates_20180409 coreutils_8.28-1ubuntu1 cpp_4:7.3.0-3ubuntu3 cpp-7_7.3.0-24ubuntu1 dash_0.5.8-2.10 debconf_1.5.67 debhelper_11.3.2ubuntu1 debianutils_4.8.6 dh-autoreconf_19 dh-strip-nondeterminism_0.042-1 diffutils_1:3.6-1 dmsetup_2:1.02.145-4.1ubuntu3 dpkg_1.19.0.5ubuntu3 dpkg-dev_1.19.0.5ubuntu3 dwz_0.12-2 e2fslibs_1.44.3~rc2-1 e2fsprogs_1.44.3~rc2-1 fakeroot_1.22-2ubuntu1 fdisk_2.32-0.1ubuntu1 file_1:5.33-3 findutils_4.6.0+git+20170828-2 g++_4:7.3.0-3ubuntu3 g++-7_7.3.0-24ubuntu1 gcc_4:7.3.0-3ubuntu3 gcc-7_7.3.0-24ubuntu1 gcc-7-base_7.3.0-24ubuntu1 gcc-8-base_8.1.0-9ubuntu1 gettext_0.19.8.1-6build1 gettext-base_0.19.8.1-6build1 gpg_2.2.8-1ubuntu1 gpg-agent_2.2.8-1ubuntu1 gpgconf_2.2.8-1ubuntu1 gpgv_2.2.8-1ubuntu1 grep_3.1-2 groff_1.22.3-10 groff-base_1.22.3-10 gzip_1.6-5ubuntu1 hostname_3.20 init_1.51 init-system-helpers_1.51 initscripts_2.88dsf-59.3ubuntu2 insserv_1.14.0-5ubuntu3 intltool-debian_0.35.0+20060710.4 libacl1_2.2.52-3build1 libapparmor1_2.12-4ubuntu6 libapt-pkg5.0_1.7.0~alpha1 libarchive-zip-perl_1.60-1 libargon2-0_0~20171227-0.1 libargon2-1_0~20171227-0.1 libasan4_7.3.0-24ubuntu1 libassuan0_2.5.1-2 libatomic1_8.1.0-9ubuntu1 libattr1_1:2.4.47-2build1 libaudit-common_1:2.8.3-1ubuntu2 libaudit1_1:2.8.3-1ubuntu2 libbinutils_2.30-22ubuntu1 libblkid1_2.32-0.1ubuntu1 libbsd0_0.9.1-1 libbz2-1.0_1.0.6-8.1 libc-bin_2.27-3ubuntu1 libc-dev-bin_2.27-3ubuntu1 libc6_2.27-3ubuntu1 libc6-dev_2.27-3ubuntu1 libcap-ng0_0.7.9-1 libcap2_1:2.25-1.2 libcc1-0_8.1.0-9ubuntu1 libcilkrts5_7.3.0-24ubuntu1 libcom-err2_1.44.3~rc2-1 libcomerr2_1.44.3~rc2-1 libcroco3_0.6.12-2 libcryptsetup12_2:2.0.2-1ubuntu2 libdb5.3_5.3.28-13.1ubuntu1 libdebconfclient0_0.213ubuntu1 libdevmapper1.02.1_2:1.02.145-4.1ubuntu3 libdpkg-perl_1.19.0.5ubuntu3 libelf1_0.170-0.5 libexpat1_2.2.5-3 libext2fs2_1.44.3~rc2-1 libfakeroot_1.22-2ubuntu1 libfdisk1_2.32-0.1ubuntu1 libffi6_3.2.1-8 libfile-stripnondeterminism-perl_0.042-1 libgcc-7-dev_7.3.0-24ubuntu1 libgcc1_1:8.1.0-9ubuntu1 libgcrypt20_1.8.2-2ubuntu1 libgdbm-compat4_1.14.1-6 libgdbm5_1.14.1-6 libglib2.0-0_2.56.1-2ubuntu1 libgmp10_2:6.1.2+dfsg-3 libgnutls30_3.5.18-1ubuntu1 libgomp1_8.1.0-9ubuntu1 libgpg-error0_1.31-1 libhogweed4_3.4-1 libice6_2:1.0.9-2 libicu60_60.2-6ubuntu1 libidn11_1.33-2.1ubuntu1 libidn2-0_2.0.4-1.1build2 libip4tc0_1.6.1-2ubuntu2 libisl19_0.19-1 libjson-c3_0.12.1-1.3 libkmod2_25-1ubuntu1 liblockfile-bin_1.14-1.1 liblockfile1_1.14-1.1 liblz4-1_1.8.2-1ubuntu1 liblzma5_5.2.2-1.3 libmagic-mgc_1:5.33-3 libmagic1_1:5.33-3 libmount1_2.32-0.1ubuntu1 libmpc3_1.1.0-1 libmpfr6_4.0.1-1 libncurses5_6.1+20180210-4ubuntu1 libncurses6_6.1+20180210-4ubuntu1 libncursesw5_6.1+20180210-4ubuntu1 libncursesw6_6.1+20180210-4ubuntu1 libnettle6_3.4-1 libnpth0_1.5-4 libp11-kit0_0.23.12-2 libpam-modules_1.1.8-3.6ubuntu2 libpam-modules-bin_1.1.8-3.6ubuntu2 libpam-runtime_1.1.8-3.6ubuntu2 libpam0g_1.1.8-3.6ubuntu2 libpcre3_2:8.39-9 libperl5.26_5.26.2-6 libpipeline1_1.5.0-1 libpng16-16_1.6.34-1 libprocps6_2:3.3.12-3ubuntu1 libprocps7_2:3.3.15-2ubuntu1 libpython-stdlib_2.7.15-3 libpython2-stdlib_2.7.15-3 libpython2.7-minimal_2.7.15-1 libpython2.7-stdlib_2.7.15-1 libreadline7_7.0-5 libruby2.5_2.5.1-1ubuntu1 libseccomp2_2.3.3-3ubuntu1 libselinux1_2.8-1build1 libsemanage-common_2.8-1build1 libsemanage1_2.8-1build1 libsepol1_2.8-1 libsigsegv2_2.12-2 libslang2_2.3.2-1ubuntu1 libsm6_2:1.2.2-1 libsmartcols1_2.32-0.1ubuntu1 libsqlite3-0_3.24.0-1 libss2_1.44.3~rc2-1 libssl1.1_1.1.0g-2ubuntu5 libstdc++-7-dev_7.3.0-24ubuntu1 libstdc++6_8.1.0-9ubuntu1 libsystemd0_238-5ubuntu2 libtasn1-6_4.13-3 libtimedate-perl_2.3000-2 libtinfo5_6.1+20180210-4ubuntu1 libtinfo6_6.1+20180210-4ubuntu1 libtool_2.4.6-2.1 libubsan0_7.3.0-24ubuntu1 libudev1_238-5ubuntu2 libunistring2_0.9.9-0ubuntu1 libusb-0.1-4_2:0.1.12-32 libuuid1_2.32-0.1ubuntu1 libx11-6_2:1.6.5-1 libx11-data_2:1.6.5-1 libxau6_1:1.0.8-1 libxaw7_2:1.0.13-1 libxcb1_1.13-1 libxdmcp6_1:1.1.2-3 libxext6_2:1.3.3-1 libxml2_2.9.4+dfsg1-7build1 libxmu6_2:1.1.2-2 libxpm4_1:3.5.12-1 libxt6_1:1.1.5-1 libyaml-0-2_0.2.1-1 libzstd1_1.3.3+dfsg-2ubuntu1 linux-libc-dev_4.17.0-4.5 lockfile-progs_0.1.17build1 login_1:4.5-1ubuntu1 lsb-base_9.20170808ubuntu1 m4_1.4.18-1 make_4.1-9.1ubuntu1 man-db_2.8.3-2 mawk_1.3.3-17ubuntu3 mime-support_3.60ubuntu1 mount_2.32-0.1ubuntu1 multiarch-support_2.27-3ubuntu1 ncurses-base_6.1+20180210-4ubuntu1 ncurses-bin_6.1+20180210-4ubuntu1 openssl_1.1.0g-2ubuntu5 optipng_0.7.6-1.1 passwd_1:4.5-1ubuntu1 patch_2.7.6-2ubuntu1 perl_5.26.2-6 perl-base_5.26.2-6 perl-modules-5.26_5.26.2-6 pinentry-curses_1.1.0-1build2 pkgbinarymangler_139 po-debconf_1.0.20 policyrcd-script-zg2_0.1-3 procps_2:3.3.15-2ubuntu1 python_2.7.15-3 python-markdown_2.6.9-1 python-minimal_2.7.15-3 python2_2.7.15-3 python2-minimal_2.7.15-3 python2.7_2.7.15-1 python2.7-minimal_2.7.15-1 rake_12.3.1-3 readline-common_7.0-5 ronn_0.7.3-5.1 ruby_1:2.5.1 ruby-did-you-mean_1.2.1-1 ruby-fast-xs_0.8.0-3build10 ruby-hpricot_0.8.6-6ubuntu3 ruby-minitest_5.10.3-1 ruby-mustache_1.0.2-1 ruby-net-telnet_0.1.1-2 ruby-power-assert_1.1.1-1 ruby-rdiscount_2.1.8-1build5 ruby-ronn_0.7.3-5.1 ruby-test-unit_3.2.7-1 ruby2.5_2.5.1-1ubuntu1 rubygems-integration_1.11 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.5-1 sensible-utils_0.0.12 systemd_238-5ubuntu2 systemd-sysv_238-5ubuntu2 sysv-rc_2.88dsf-59.3ubuntu2 sysvinit-utils_2.88dsf-59.10ubuntu1 tar_1.30+dfsg-2 tzdata_2018e-1 ubuntu-keyring_2018.02.28 util-linux_2.32-0.1ubuntu1 x11-common_1:7.7+19ubuntu8 xz-utils_5.2.2-1.3 zlib1g_1:1.2.11.dfsg-0ubuntu2 zlib1g-dev_1:1.2.11.dfsg-0ubuntu2 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- gpgv: Signature made Mon Jul 9 07:34:12 2018 UTC gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-3.dsc dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-3.debian.tar.xz dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch Check disc space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-15101291 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-15101291 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-15101291 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-3 dpkg-buildpackage: info: source distribution unstable dpkg-source --before-build seqprep-1.3.2 dpkg-buildpackage: info: host architecture armhf fakeroot debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/<>' debian/rules override_dh_clean make[1]: Entering directory '/<>' dh_clean rm -f seqprep rm -f debian/*.1 rm -f README.html make[1]: Leaving directory '/<>' debian/rules build-arch dh build-arch dh_update_autotools_config -a dh_autoreconf -a dh_auto_configure -a debian/rules override_dh_auto_build make[1]: Entering directory '/<>' dh_auto_build make -j4 "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>' cc -g -O2 -fdebug-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -fdebug-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -fdebug-prefix-map=/<>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function ‘main’: SeqPrep.c:166:15: warning: implicit declaration of function ‘getopt’; did you mean ‘getgid’? [-Wimplicit-function-declaration] while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { ^~~~~~ getgid cc SeqPrep.o utils.o stdaln.o -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/<>' cp SeqPrep seqprep TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn roff: debian/seqprep.1 markdown_py -f README.html README.md make[1]: Leaving directory '/<>' debian/rules override_dh_auto_test make[1]: Entering directory '/<>' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.534486 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.510932 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python seqlens.py ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/<>' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary-arch dh binary-arch dh_testroot -a dh_prep -a dh_auto_install -a make -j4 install DESTDIR=/<>/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/<>' cp SeqPrep /sbuild-nonexistent/bin cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory Makefile:15: recipe for target 'install' failed make[1]: [install] Error 1 (ignored) make[1]: Leaving directory '/<>' dh_install -a dh_installdocs -a dh_installchangelogs -a dh_installman -a dh_perl -a dh_link -a dh_strip_nondeterminism -a dh_compress -a dh_fixperms -a dh_missing -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb -a dh_gencontrol -a dh_md5sums -a dh_builddeb -a INFO: pkgstriptranslations version 139 INFO: pkgstriptranslations version 139 pkgstriptranslations: processing seqprep (in debian/seqprep); do_strip: , oemstrip: pkgstriptranslations: processing seqprep-dbgsym (in debian/.debhelper/seqprep/dbgsym-root); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/seqprep/DEBIAN/control, package seqprep, directory debian/seqprep pkgstripfiles: processing control file: debian/.debhelper/seqprep/dbgsym-root/DEBIAN/control, package seqprep-dbgsym, directory debian/.debhelper/seqprep/dbgsym-root pkgstripfiles: Running PNG optimization (using 4 cpus) for package seqprep-dbgsym ... pkgstripfiles: No PNG files. dpkg-deb: building package 'seqprep-dbgsym' in 'debian/.debhelper/scratch-space/build-seqprep/seqprep-dbgsym_1.3.2-3_armhf.deb'. pkgstripfiles: Truncating usr/share/doc/seqprep/changelog.Debian.gz to topmost ten records pkgstripfiles: Running PNG optimization (using 4 cpus) for package seqprep ... pkgstripfiles: No PNG files. Renaming seqprep-dbgsym_1.3.2-3_armhf.deb to seqprep-dbgsym_1.3.2-3_armhf.ddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-3_armhf.deb'. dpkg-genbuildinfo --build=any dpkg-genchanges --build=any -mLaunchpad Build Daemon >../seqprep_1.3.2-3_armhf.changes dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included) dpkg-source --after-build seqprep-1.3.2 dpkg-buildpackage: info: binary-only upload (no source included) -------------------------------------------------------------------------------- Build finished at 20180709-1118 Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Post Build Chroot | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ seqprep_1.3.2-3_armhf.changes: ------------------------------ Format: 1.8 Date: Fri, 06 Jul 2018 15:26:19 +0200 Source: seqprep Binary: seqprep seqprep-data Architecture: armhf Version: 1.3.2-3 Distribution: cosmic-proposed Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 903071 Changes: seqprep (1.3.2-3) unstable; urgency=medium . * Build-Depends: ruby-ronn -> ronn Closes: #903071 * debhelper 11 * Point Vcs fields to salsa.debian.org * Standards-Version: 4.1.4 Checksums-Sha1: 51d31eccac61fa48a11aef7f469ab478f0724311 16480 seqprep-dbgsym_1.3.2-3_armhf.ddeb 70240b05060126622f80af69d6df3602c72eb7f1 6327 seqprep_1.3.2-3_armhf.buildinfo f697435fbe3cd0287d5a1d7e521684220e0e0a96 27576 seqprep_1.3.2-3_armhf.deb Checksums-Sha256: 3bdad504069038ae4bea94c879be6c7349c7e970d89f51b9378b707134d10776 16480 seqprep-dbgsym_1.3.2-3_armhf.ddeb 2af8f93979a1c414c9c7c1397cf8834e997fd26452ea931fb7eda69bc16cd9ff 6327 seqprep_1.3.2-3_armhf.buildinfo 740a782b12e2fefac52bc4597f1e7cf166562f0b8b3d90281c95bff1cf9f5957 27576 seqprep_1.3.2-3_armhf.deb Files: ceabbaa5a150537d98a0aee43f327b8a 16480 debug optional seqprep-dbgsym_1.3.2-3_armhf.ddeb 1f4d9ad5fbc9d88506f4e4c28c7be0bb 6327 science optional seqprep_1.3.2-3_armhf.buildinfo 5c9ad58ca0a070ed8f3357ad39a8ade0 27576 science optional seqprep_1.3.2-3_armhf.deb +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ seqprep_1.3.2-3_armhf.deb ------------------------- new debian package, version 2.0. size 27576 bytes: control archive=1144 bytes. 1250 bytes, 22 lines control 326 bytes, 5 lines md5sums Package: seqprep Version: 1.3.2-3 Architecture: armhf Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 90 Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4) Section: science Priority: optional Homepage: http://seqanswers.com/wiki/SeqPrep Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap SeqPrep is a program to merge paired end Illumina reads that are overlapping into a single longer read. It may also just be used for its adapter trimming feature without doing any paired end overlap. When an adapter sequence is present, that means that the two reads must overlap (in most cases) so they are forcefully merged. When reads do not have adapter sequence they must be treated with care when doing the merging, so a much more specific approach is taken. The default parameters were chosen with specificity in mind, so that they could be ran on libraries where very few reads are expected to overlap. It is always safest though to save the overlapping procedure for libraries where you have some prior knowledge that a significant portion of the reads will have some overlap. drwxr-xr-x root/root 0 2018-07-06 13:26 ./ drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/ drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/bin/ -rwxr-xr-x root/root 61888 2018-07-06 13:26 ./usr/bin/seqprep drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/ drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/doc/ drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/doc/seqprep/ -rw-r--r-- root/root 11749 2018-07-06 13:26 ./usr/share/doc/seqprep/README.html -rw-r--r-- root/root 992 2018-07-06 13:26 ./usr/share/doc/seqprep/changelog.Debian.gz -rw-r--r-- root/root 1439 2018-07-06 13:26 ./usr/share/doc/seqprep/copyright drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/man/ drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/man/man1/ -rw-r--r-- root/root 4566 2018-07-06 13:26 ./usr/share/man/man1/seqprep.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: armhf Build-Space: 65084 Build-Time: 77 Distribution: cosmic-proposed Host Architecture: armhf Install-Time: 26 Job: seqprep_1.3.2-3.dsc Machine Architecture: arm64 Package: seqprep Package-Time: 107 Source-Version: 1.3.2-3 Space: 65084 Status: successful Version: 1.3.2-3 -------------------------------------------------------------------------------- Finished at 20180709-1118 Build needed 00:01:47, 65084k disc space RUN: /usr/share/launchpad-buildd/slavebin/in-target scan-for-processes --backend=chroot --series=cosmic --arch=armhf PACKAGEBUILD-15101291 Scanning for processes to kill in build PACKAGEBUILD-15101291