diff -Nru micommons-0.9/.flow micommons-1.0.3/.flow
--- micommons-0.9/.flow	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/.flow	1970-01-01 00:00:00.000000000 +0000
@@ -1,8 +0,0 @@
-[branchname]
-master = default
-develop = develop
-feature = feature/
-release = release/
-hotfix = hotfix/
-support = support/
-
diff -Nru micommons-0.9/.hg_archival.txt micommons-1.0.3/.hg_archival.txt
--- micommons-0.9/.hg_archival.txt	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/.hg_archival.txt	1970-01-01 00:00:00.000000000 +0000
@@ -1,4 +0,0 @@
-repo: 256a85dfd848a123631913fbf5215ad4892ba477
-node: cf232f28ff5ae38774a32f53d8897048a5e3de99
-branch: default
-tag: v0.9
diff -Nru micommons-0.9/.hgignore micommons-1.0.3/.hgignore
--- micommons-0.9/.hgignore	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/.hgignore	1970-01-01 00:00:00.000000000 +0000
@@ -1,8 +0,0 @@
-target/
-nbactions.*\.xml$
-nb-configuration.xml$
-\.log$
-\.log\.
-\.iml$
-.idea\/
-\.DS_Store$
diff -Nru micommons-0.9/debian/changelog micommons-1.0.3/debian/changelog
--- micommons-0.9/debian/changelog	2013-08-15 12:38:34.000000000 +0000
+++ micommons-1.0.3/debian/changelog	2013-10-10 19:46:32.000000000 +0000
@@ -1,3 +1,9 @@
+micommons (1.0.3-1~raring) raring; urgency=low
+
+  * 1.0.3 Release.
+
+ -- Dmitriy Bolotin <bolotin.dmitriy@gmail.com>  Thu, 10 Oct 2013 18:24:35 +0400
+
 micommons (0.9-2~raring) raring; urgency=low
 
   * Jar is now present in /usr/share/java
diff -Nru micommons-0.9/pom.xml micommons-1.0.3/pom.xml
--- micommons-0.9/pom.xml	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/pom.xml	2013-10-09 08:03:10.000000000 +0000
@@ -24,9 +24,10 @@
 
     <groupId>com.milaboratory</groupId>
     <artifactId>micommons</artifactId>
-    <version>0.9</version>
+    <version>1.0.3</version>
     <packaging>jar</packaging>
     <name>MiCommons</name>
+    <url>http://mitcr.milaboratory.com/</url>
 
     <parent>
         <groupId>org.sonatype.oss</groupId>
@@ -112,11 +113,16 @@
     </properties>
 
     <scm>
-        <connection>scm:hg:http://bitbucket.org/milaboratory/micommons</connection>
-        <tag>v0.9</tag>
-        <url>https://bitbucket.org/milaboratory/micommons/src/?at=v0.9</url>
+        <connection>scm:hg:http://bitbucket.org/milaboratory/mitcr</connection>
+        <tag>v1.0.3</tag>
+        <url>https://bitbucket.org/milaboratory/mitcr/src/?at=1.0.3</url>
     </scm>
 
+    <issueManagement>
+        <system>YouTrack</system>
+        <url>http://dev.milaboratory.com/</url>
+    </issueManagement>
+
     <build>
         <plugins>
             <!-- TO BE ACTIVATED IN FUTURE -->
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/Alphabet.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/Alphabet.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/Alphabet.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/Alphabet.java	2013-10-09 08:03:10.000000000 +0000
@@ -50,7 +50,7 @@
      */
     public byte codeFromSymbol(char symbol);
 
-    public SequenceBuilderFactory getSequenceBuilderFactory();
+    public SequenceBuilderFactory getBuilderFactory();
 
     /**
      * Id of alphabet
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/NucleotideSQPair.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/NucleotideSQPair.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/NucleotideSQPair.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/NucleotideSQPair.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,12 +21,8 @@
 package com.milaboratory.core.sequence;
 
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
-import com.milaboratory.core.sequence.util.NucleotideRCSequence;
-import com.milaboratory.core.sequence.util.NucleotideSubSequence;
-import com.milaboratory.core.sequence.util.SequenceQualityUtils;
-import com.milaboratory.core.sequence.util.SubSequenceQuality;
+import com.milaboratory.core.sequence.quality.SequenceQualityUtils;
 
 import java.io.Serializable;
 
@@ -42,30 +38,30 @@
 public final class NucleotideSQPair implements Serializable {
     private static final long serialVersionUID = 1L;
 
-    private NucleotideSequence sequence;
-    private SequenceQuality quality;
+    private final NucleotideSequence sequence;
+    private final SequenceQualityPhred quality;
 
     public NucleotideSQPair(String sequence) {
-        this(NucleotideSequenceImpl.fromSequence(sequence));
+        this(new NucleotideSequence(sequence));
+    }
+
+    public NucleotideSQPair(NucleotideSequence sequence) {
+        this.sequence = sequence;
+        this.quality = SequenceQualityUtils.createGoodQualityObject(sequence.size());
     }
 
     public NucleotideSQPair(String sequence, String quality) {
-        this(NucleotideSequenceImpl.fromSequence(sequence),
+        this(new NucleotideSequence(sequence),
                 new SequenceQualityPhred(quality));
     }
 
-    public NucleotideSQPair(NucleotideSequence sequence, SequenceQuality quality) {
+    public NucleotideSQPair(NucleotideSequence sequence, SequenceQualityPhred quality) {
         if (sequence.size() != quality.size())
             throw new IllegalArgumentException();
         this.sequence = sequence;
         this.quality = quality;
     }
 
-    public NucleotideSQPair(NucleotideSequence sequence) {
-        this.sequence = sequence;
-        this.quality = SequenceQualityUtils.getGoodQualityObject(sequence.size());
-    }
-
     /**
      * Generates a new instance of NucleotideSQPair containing sub sequence. If to &lt; from then reverse complement
      * will be returned.
@@ -73,27 +69,28 @@
      * @param from inclusive
      * @param to   exclusive
      */
-    public NucleotideSQPair getSubPairCopy(int from, int to) {
+    //TODO test required
+    public NucleotideSQPair getRange(int from, int to) {
         if (from >= size() || from < 0 || to > size() || to < 0)
             throw new IndexOutOfBoundsException("\"from\" or \"to\" are out of range.");
         NucleotideSequence s;
-        SequenceQuality q;
+        SequenceQualityPhred q;
         if (to < from) {
-            s = new NucleotideRCSequence(new NucleotideSubSequence(sequence, to + 1, from - to));
-            q = new SubSequenceQuality(quality, to + 1, from - to).reverse();
+            s = sequence.getRange(to + 1, from + 1).getReverseComplement(); //TODO possible optimization point
+            //new NucleotideRCSequence(new NucleotideSubSequence(sequence, to + 1, from - to));
+            q = quality.getRange(to + 1, from + 1).reverse(); //TODO possible optimization point
+            //new SubSequenceQuality(quality, to + 1, from - to).reverse();
         } else {
-            s = new NucleotideSubSequence(sequence, from, to - from);
-            q = new SubSequenceQuality(quality, from, to - from);
+            s = sequence.getRange(from, to);
+            //new NucleotideSubSequence(sequence, from, to - from);
+            q = quality.getRange(from, to);
+            //new SubSequenceQuality(quality, from, to - from);
         }
         return new NucleotideSQPair(s, q);
     }
 
     public NucleotideSQPair getRC() {
-        return new NucleotideSQPair(new NucleotideRCSequence(sequence), quality.reverse());
-    }
-
-    public NucleotideSQPair getDeepCopy() {
-        return new NucleotideSQPair(NucleotideSequenceImpl.fromSequence(sequence), SequenceQualityUtils.copy(quality));
+        return new NucleotideSQPair(sequence.getReverseComplement(), quality.reverse());
     }
 
     public int size() {
@@ -104,7 +101,7 @@
         return sequence;
     }
 
-    public SequenceQuality getQuality() {
+    public SequenceQualityPhred getQuality() {
         return quality;
     }
 
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/SequenceQuality.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/SequenceQuality.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/SequenceQuality.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/SequenceQuality.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,101 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence;
-
-
-/**
- * Parent class for all sequence quality classes.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public interface SequenceQuality {
-    Class<? extends SequenceQuality> getBaseClass();
-
-    /**
-     * Get the probability of error (e.g. nucleotide substitution) at given sequence point
-     *
-     * @param coord coordinate in sequence
-     * @return probability of error
-     */
-    float probabilityOfErrorAt(int coord);
-
-    /**
-     * Get the log10 of probability of error (e.g. nucleotide substitution) at given sequence point
-     *
-     * @param coord coordinate in sequence
-     * @return log10 of probability of error
-     */
-    float log10ProbabilityOfErrorAt(int coord);
-
-    /**
-     * Get the raw sequence quality value (in binary format) at given sequence point
-     *
-     * @param coord coordinate in sequence
-     * @return raw sequence quality value
-     */
-    byte rawQualityValue(int coord);
-
-    /**
-     * Sets the raw sequence quality value (in binary format) at given sequence point
-     *
-     * @param coord coordinate in sequence
-     */
-    void setRawQualityValue(int coord, byte value);
-
-    /**
-     * Get the worst raw sequence quality value (in binary format) in all sequence
-     *
-     * @return worst raw sequence quality value
-     */
-    byte minRawQuality();
-
-    /**
-     * Merges two quality arrays by choosing the best quality at each position
-     *
-     * @param quality other quality array
-     */
-    void mergeWith(SequenceQuality quality);
-
-    /**
-     * Gets the qualities of characters in reverse order
-     *
-     * @return reverse of quality array
-     */
-    SequenceQuality reverse();
-
-    /**
-     * Gets the size of quality array
-     *
-     * @return size of quality array
-     */
-    int size();
-
-    byte[] encode(byte offset);
-
-    /**
-     * Default quality thresholds
-     */
-    public static class Constants {
-        public static final byte goodQuality = 34;
-        public static final byte badQuality = 3;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/aminoacid/AminoAcidAlphabet.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/aminoacid/AminoAcidAlphabet.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/aminoacid/AminoAcidAlphabet.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/aminoacid/AminoAcidAlphabet.java	2013-10-09 08:03:10.000000000 +0000
@@ -103,7 +103,7 @@
     };
 
     @Override
-    public SequenceBuilderFactory<AminoAcidSequence> getSequenceBuilderFactory() {
+    public SequenceBuilderFactory<AminoAcidSequence> getBuilderFactory() {
         return FACTORY;
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/aminoacid/CDRAminoAcidAlphabet.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/aminoacid/CDRAminoAcidAlphabet.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/aminoacid/CDRAminoAcidAlphabet.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/aminoacid/CDRAminoAcidAlphabet.java	2013-10-09 08:03:10.000000000 +0000
@@ -107,7 +107,7 @@
     };
 
     @Override
-    public SequenceBuilderFactory getSequenceBuilderFactory() {
+    public SequenceBuilderFactory getBuilderFactory() {
         return FACTORY;
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/SSequencingReadBindings.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/SSequencingReadBindings.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/SSequencingReadBindings.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/SSequencingReadBindings.java	2013-10-09 08:03:10.000000000 +0000
@@ -40,7 +40,7 @@
                 return new LowQualityIndicator() {
                     @Override
                     public boolean isLowQuality(int point) {
-                        return object.getData().getQuality().rawQualityValue(point) < minQuality;
+                        return object.getData().getQuality().value(point) < minQuality;
                     }
                 };
             }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearch.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearch.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearch.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearch.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,24 @@
+package com.milaboratory.core.sequence.motif.search;
+
+import com.milaboratory.core.sequence.motif.NucleotideMotif;
+
+public class NucleotideMotifSearch {
+    private final NucleotideMotif motif;
+    private final NucleotideMotifSearchOptions options;
+    private final int exactRegionFrom, exactRegionTo;
+
+    public NucleotideMotifSearch(NucleotideMotif motif, NucleotideMotifSearchOptions options, int exactRegionFrom, int exactRegionTo) {
+        this.motif = motif;
+        this.options = options;
+        this.exactRegionFrom = exactRegionFrom;
+        this.exactRegionTo = exactRegionTo;
+    }
+
+//    public int nextMatch(int from, NucleotideSequence sequence) {
+//        if (exactRegionFrom >= 0) { //If exact region exists
+//            for (int i = 0; i < sequence.size(); ++i) {
+//
+//            }
+//        }
+//    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearchOptions.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearchOptions.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearchOptions.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/motif/search/NucleotideMotifSearchOptions.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,17 @@
+package com.milaboratory.core.sequence.motif.search;
+
+public class NucleotideMotifSearchOptions {
+    public static NucleotideMotifSearchOptions NORMAL_WITH_TRUNCATION = new NucleotideMotifSearchOptions(2, 1, 1, 2, 2);
+    public static NucleotideMotifSearchOptions NORMAL_WITHOUT_TRUNCATION = new NucleotideMotifSearchOptions(2, 1, 1, 2, 0);
+
+    public final int maxMismatches, maxDeletions, maxInsertions, maxTotalErrors;
+    public final int maxLeftTruncation;
+
+    public NucleotideMotifSearchOptions(int maxMismatches, int maxDeletions, int maxInsertions, int maxTotalErrors, int maxLeftTruncation) {
+        this.maxMismatches = maxMismatches;
+        this.maxDeletions = maxDeletions;
+        this.maxInsertions = maxInsertions;
+        this.maxTotalErrors = maxTotalErrors;
+        this.maxLeftTruncation = maxLeftTruncation;
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabet.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabet.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabet.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabet.java	2013-10-09 08:03:10.000000000 +0000
@@ -77,7 +77,7 @@
     }
 
     @Override
-    public SequenceBuilderFactory getSequenceBuilderFactory() {
+    public SequenceBuilderFactory getBuilderFactory() {
         return NucleotideSequenceBuilder.FACTORY;
     }
 
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabetWithN.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabetWithN.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabetWithN.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideAlphabetWithN.java	2013-10-09 08:03:10.000000000 +0000
@@ -72,7 +72,7 @@
     }
 
     @Override
-    public SequenceBuilderFactory getSequenceBuilderFactory() {
+    public SequenceBuilderFactory getBuilderFactory() {
         throw new UnsupportedOperationException();
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequence.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequence.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequence.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequence.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,6 +22,11 @@
 
 import com.milaboratory.core.sequence.Alphabet;
 import com.milaboratory.core.sequence.Sequence;
+import com.milaboratory.util.Bit2Array;
+
+import java.io.Serializable;
+
+import static com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet.INSTANCE;
 
 /**
  * Nucleotide sequence.
@@ -29,9 +34,83 @@
  * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
  * @author Shugay Mikhail (mikhail.shugay@gmail.com)
  */
-public abstract class NucleotideSequence extends Sequence {
+public final class NucleotideSequence extends Sequence implements Serializable {
+    private static final long serialVersionUID = 1L;
+    final Bit2Array data;
+
+    public NucleotideSequence(String sequence) {
+        data = new Bit2Array(sequence.length());
+        byte code;
+        for (int i = 0; i < sequence.length(); ++i)
+            data.set(i, INSTANCE.codeFromSymbol(sequence.charAt(i)));
+    }
+
+    public NucleotideSequence(char[] sequence) {
+        data = new Bit2Array(sequence.length);
+        byte code;
+        for (int i = 0; i < sequence.length; ++i)
+            data.set(i, INSTANCE.codeFromSymbol(sequence[i]));
+    }
+
+
+    public NucleotideSequence(Bit2Array data) {
+        this.data = data.clone();
+    }
+
+    NucleotideSequence(Bit2Array data, boolean unsafe) {
+        this.data = data;
+    }
+
+    @Override
+    public byte codeAt(int position) {
+        return (byte) data.get(position);
+    }
+
+    @Override
+    public int size() {
+        return data.size();
+    }
+
+    public NucleotideSequence getRange(int from, int to) {
+        return new NucleotideSequence(data.getRange(from, to), true);
+    }
+
+    /**
+     * Returns reverse complement of this sequence.
+     *
+     * @return reverse complement sequence
+     */
+    public NucleotideSequence getReverseComplement() {
+        return new NucleotideSequence(transformToRC(data), true);
+    }
+
+    public Bit2Array getInnerData() {
+        return data.clone();
+    }
+
     @Override
     public Alphabet getAlphabet() {
-        return NucleotideAlphabet.INSTANCE;
+        return INSTANCE;
+    }
+
+    public static NucleotideSequence fromStorage(Bit2Array b2a) {
+        return new NucleotideSequence(b2a.clone(), true);
+    }
+
+    public static NucleotideSequence fromSequence(byte[] sequence, int offset, int length) {
+        Bit2Array storage = new Bit2Array(length);
+        for (int i = 0; i < length; ++i)
+            storage.set(i, INSTANCE.codeFromSymbol((char) sequence[offset + i]));
+        return new NucleotideSequence(storage, true);
+    }
+
+    private static Bit2Array transformToRC(Bit2Array data) {
+        Bit2Array newData = new Bit2Array(data.size());
+        int reverseCoord;
+        for (int coord = 0; coord < data.size(); coord++) {
+            reverseCoord = data.size() - 1 - coord;
+            newData.set(coord, (~data.get(reverseCoord)) & 0x3);
+        }
+        return newData;
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregator.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregator.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregator.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregator.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,119 +0,0 @@
-package com.milaboratory.core.sequence.nucleotide;
-
-import com.milaboratory.util.Bit2Array;
-
-public class NucleotideSequenceAggregator {
-    final long[] observations;
-    long sequences = 0;
-    final int length, delta;
-
-    public NucleotideSequenceAggregator(int length, int delta) {
-        this.observations = new long[(length + 2 * delta) * 4];
-        this.length = length;
-        this.delta = delta;
-    }
-
-    public long getObservations(int position, int code) {
-        if (code < 0 || code >= 4 || position < 0 || position >= length + 2 * delta)
-            throw new IllegalArgumentException();
-
-        return observations[position * 4 + code];
-    }
-
-    private long getScore(NucleotideSequence sequence, int d) {
-        long result = 0;
-
-        for (int i = sequence.size() - 1; i >= 0; --i)
-            result += observations[(delta + i + d) * 4 + sequence.codeAt(i)];
-
-        return result;
-    }
-
-    public long getSequences() {
-        return sequences;
-    }
-
-    private void putSequence(NucleotideSequence sequence, int d) {
-        ++sequences;
-        for (int i = sequence.size() - 1; i >= 0; --i)
-            ++observations[(delta + i + d) * 4 + sequence.codeAt(i)];
-    }
-
-    public void putSequence(NucleotideSequence sequence) {
-        if (sequence.size() != length)
-            throw new IllegalArgumentException();
-
-        if (sequences == 0) {
-            putSequence(sequence, 0);
-            return;
-        }
-
-        int maxD = 0;
-        long maxScore = getScore(sequence, 0), score;
-
-        for (int d = 1; d <= delta; ++d) {
-            if ((score = getScore(sequence, d)) > maxScore) {
-                maxScore = score;
-                maxD = d;
-            }
-            if ((score = getScore(sequence, -d)) > maxScore) {
-                maxScore = score;
-                maxD = -d;
-            }
-        }
-
-        putSequence(sequence, maxD);
-    }
-
-    public NucleotideSequence getSequence(double minPercent) {
-        int start = 0, end = 0, lastBad = -1;
-        byte maxCode, code;
-        long maxCount, sum;
-        double percent;
-
-        for (int i = 0; i < length + delta * 2; ++i) {
-            //maxCode = -1;
-            maxCount = 0;
-            sum = 0;
-
-            for (code = 0; code < 4; ++code) {
-                sum += observations[i * 4 + code];
-                if (maxCount < observations[i * 4 + code]) {
-                    maxCount = observations[i * 4 + code];
-                    //maxCode = code;
-                }
-            }
-
-            if (sum == 0) {
-                lastBad = i;
-                continue;
-            }
-
-            percent = 1.0 * maxCount / sum;
-
-            if (percent < minPercent)
-                lastBad = i;
-            else if (end - start < i - lastBad) {
-                end = i + 1;
-                start = lastBad + 1;
-            }
-        }
-
-        Bit2Array st = new Bit2Array(end - start);
-
-        for (int i = start; i < end; ++i) {
-            maxCode = -1;
-            maxCount = 0;
-
-            for (code = 0; code < 4; ++code)
-                if (maxCount < observations[i * 4 + code]) {
-                    maxCount = observations[i * 4 + code];
-                    maxCode = code;
-                }
-
-            st.set(i - start, maxCode);
-        }
-
-        return NucleotideSequenceImpl.fromStorage(st);
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceBuilder.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceBuilder.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceBuilder.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceBuilder.java	2013-10-09 08:03:10.000000000 +0000
@@ -25,7 +25,7 @@
 import com.milaboratory.util.Bit2Array;
 
 /**
- * Creates {@link NucleotideSequenceImpl}.
+ * Creates {@link NucleotideSequence}.
  */
 public class NucleotideSequenceBuilder implements SequenceBuilder<NucleotideSequence> {
     public static final SequenceBuilderFactory<NucleotideSequence> FACTORY = new SequenceBuilderFactory<NucleotideSequence>() {
@@ -47,7 +47,7 @@
 
     @Override
     public NucleotideSequence create() {
-        return NucleotideSequenceImpl.fromStorage(storage);
+        return new NucleotideSequence(storage);
     }
 
     @Override
@@ -57,15 +57,6 @@
 
     @Override
     public void copyFrom(NucleotideSequence sequence, int otherOffset, int thisOffset, int length) {
-        if (sequence instanceof NucleotideSequenceImpl)
-            storage.copyFrom(((NucleotideSequenceImpl) sequence).data, otherOffset, thisOffset, length);
-        else {
-            if (thisOffset < 0 || thisOffset + length > storage.size() ||
-                    otherOffset < 0 || otherOffset + length > sequence.size())
-                throw new IndexOutOfBoundsException();
-
-            for (int i = 0; i < length; ++i)
-                storage.set(i + thisOffset, sequence.codeAt(i + otherOffset));
-        }
+        storage.copyFrom(sequence.data, otherOffset, thisOffset, length);
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceImpl.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceImpl.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceImpl.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceImpl.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,120 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence.nucleotide;
-
-import com.milaboratory.core.sequence.Sequence;
-import com.milaboratory.util.Bit2Array;
-
-import java.io.Serializable;
-
-/**
- * Main implementation of nucleotide sequence.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public class NucleotideSequenceImpl extends NucleotideSequence implements Serializable {
-    private static final long serialVersionUID = 1L;
-
-    final Bit2Array data;
-
-    protected NucleotideSequenceImpl(Bit2Array data) {
-        this.data = data;
-    }
-
-    @Override
-    public byte codeAt(int position) {
-        return (byte) data.get(position);
-    }
-
-    @Override
-    public Sequence clone() {
-        return new NucleotideSequenceImpl(data.clone());
-    }
-
-    @Override
-    public int size() {
-        return data.size();
-    }
-
-    public Bit2Array getInnerStorage() {
-        return data;
-    }
-
-    /*@Override
-    public boolean equals(Object obj) {
-        if (obj == null)
-            return false;
-        if (!(obj instanceof NucleotideSequenceImpl))
-            return false;
-        final NucleotideSequenceImpl other = (NucleotideSequenceImpl) obj;
-        if (!this.data.equals(other.data))
-            return false;
-        return true;
-    }
-
-    @Override
-    public int hashCode() {
-        int hash = 5;
-        hash = 83 * hash + this.data.hashCode();
-        return hash;
-    }*/
-
-    public static NucleotideSequenceImpl fromStorage(Bit2Array b2a) {
-        return new NucleotideSequenceImpl(b2a);
-    }
-
-    public static NucleotideSequenceImpl fromSequence(char[] sequence) {
-        Bit2Array storage = new Bit2Array(sequence.length);
-        byte code;
-        for (int i = 0; i < sequence.length; ++i) {
-            code = NucleotideAlphabet.INSTANCE.codeFromSymbol(sequence[i]);
-            if (code > 3)
-                throw new RuntimeException("This sequence doesn't support 'N/n' nucleotides.");
-            storage.set(i, code);
-        }
-        return new NucleotideSequenceImpl(storage);
-    }
-
-    public static NucleotideSequenceImpl fromSequence(String sequence) {
-        return fromSequence(sequence.toCharArray());
-    }
-
-    public static NucleotideSequenceImpl fromSequence(NucleotideSequence sequence) {
-        return new NucleotideSequenceImpl(storageFromSequence(sequence));
-    }
-
-    public static Bit2Array storageFromSequence(NucleotideSequence sequence) {
-        if (sequence instanceof NucleotideSequenceImpl)
-            return ((NucleotideSequenceImpl) sequence).data.clone();
-        Bit2Array storage = new Bit2Array(sequence.size());
-        for (int i = 0; i < sequence.size(); ++i)
-            storage.set(i, sequence.codeAt(i));
-        return storage;
-    }
-
-    public static NucleotideSequenceImpl fromSequence(byte[] sequence, int offset, int length) {
-        Bit2Array storage = new Bit2Array(length);
-        for (int i = 0; i < length; ++i)
-            storage.set(i, NucleotideAlphabet.INSTANCE.codeFromSymbol((char) sequence[offset + i]));
-        return new NucleotideSequenceImpl(storage);
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/QualityFormat.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/QualityFormat.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/QualityFormat.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/QualityFormat.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,70 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequence.quality;
+
+/**
+ * A base class to store various sequencing quality formats.
+ *
+ * See corresponding Wikipedia page for details: <a href="http://en.wikipedia.org/wiki/FASTQ_format">link</a>.
+ */
+public enum QualityFormat {
+    /**
+     * Phred quality values encoded with 33 value offset. <p>Allowed quality score values range is 0-50.</p>
+     */
+    Phred33((byte) 33, (byte) 0, (byte) 50, "phred33"),
+    /**
+     * Phred quality values encoded with 64 value offset. <p>Allowed quality score values range is 0-41.</p>
+     */
+    Phred64((byte) 64, (byte) 0, (byte) 41, "phred64");
+    private byte offset, minValue, maxValue;
+    private String name;
+
+    private QualityFormat(byte offset, byte minValue, byte maxVaule, String name) {
+        this.offset = offset;
+        this.minValue = minValue;
+        this.maxValue = maxVaule;
+        this.name = name;
+    }
+
+    public byte getMinValue() {
+        return minValue;
+    }
+
+    public byte getMaxValue() {
+        return maxValue;
+    }
+
+    public byte getOffset() {
+        return offset;
+    }
+
+    public static QualityFormat fromXML(String xml) {
+        for (QualityFormat format : values())
+            if (format.name.equalsIgnoreCase(xml))
+                return format;
+        return null;
+    }
+
+    @Override
+    public String toString() {
+        return name;
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityPhred.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityPhred.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityPhred.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityPhred.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,70 +20,117 @@
  */
 package com.milaboratory.core.sequence.quality;
 
-import com.milaboratory.core.sequence.SequenceQuality;
-
 import java.io.Serializable;
 import java.util.Arrays;
 
 /**
  * Implementation sequence quality.
  *
- * <p>Phred sequence quality format used. It is common format for all new fastq formats (Sanger, Solexa v1.4+).</p>
+ * <p>Phred sequence quality scores.</p>
  *
  * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
  * @author Shugay Mikhail (mikhail.shugay@gmail.com)
  */
-public final class SequenceQualityPhred implements SequenceQuality, Serializable {
+public final class SequenceQualityPhred implements Serializable {
     private static final long serialVersionUID = 1L;
+    private final byte[] data;
 
-    private byte[] data;
-
+    /**
+     * Creates a phred sequence quality from a Sanger formatted quality string (33 based).
+     *
+     * @param string
+     */
     public SequenceQualityPhred(String string) {
         this(string, 33);
     }
 
+    /**
+     * Creates a phred sequence quality from a string formatted with corresponding offset.
+     *
+     * @param string
+     */
     public SequenceQualityPhred(String string, int offset) {
         this.data = string.getBytes();
         for (int i = this.data.length - 1; i >= 0; --i)
             this.data[i] -= offset;
     }
 
+    /**
+     * Creates a phred sequence quality from a string formatted with corresponding offset.
+     *
+     * @param string
+     */
+    public SequenceQualityPhred(String string, QualityFormat format) {
+        this(string, format.getOffset());
+    }
+
+    public byte[] getInnerData() {
+        return data.clone();
+    }
+
+    /**
+     * Creates a phred sequence quality containing only given values of quality.
+     *
+     * @param value  value to fill the quality values with
+     * @param length size of quality string
+     */
     public SequenceQualityPhred(byte value, int length) {
         data = new byte[length];
         Arrays.fill(data, value);
     }
 
+    /**
+     * Creates quality object from raw quality score values.
+     *
+     * @param data raw quality score values
+     */
     public SequenceQualityPhred(byte[] data) {
-        this.data = data;
+        this.data = data.clone();
     }
 
-    @Override
-    public Class<? extends SequenceQuality> getBaseClass() {
-        return SequenceQualityPhred.class;
+    /**
+     * Constructor for factory method.
+     */
+    private SequenceQualityPhred(byte[] data, boolean unsafe) {
+        this.data = data;
     }
 
-    @Override
+    /**
+     * Get the log10 of probability of error (e.g. nucleotide substitution) at given sequence point
+     *
+     * @param coord coordinate in sequence
+     * @return log10 of probability of error
+     */
     public float log10ProbabilityOfErrorAt(int coord) {
         return -((float) data[coord]) / 10;
     }
 
-    @Override
+    /**
+     * Get probability of error (e.g. nucleotide substitution) at given sequence point
+     *
+     * @param coord coordinate in sequence
+     * @return probability of error
+     */
     public float probabilityOfErrorAt(int coord) {
         return (float) Math.pow(10.0, -(data[coord]) / 10);
     }
 
-    @Override
-    public byte rawQualityValue(int coord) {
+    /**
+     * Get the raw sequence quality value (in binary format) at given sequence point
+     *
+     * @param coord coordinate in sequence
+     * @return raw sequence quality value
+     */
+    public byte value(int coord) {
         return data[coord];
     }
 
-    @Override
-    public void setRawQualityValue(int coord, byte value) {
-        data[coord] = value;
-    }
-
-    @Override
-    public byte minRawQuality() {
+    /**
+     * Returns the worst sequence quality value
+     *
+     * @return worst sequence quality value
+     */
+    public byte minValue() {
         byte min = Byte.MAX_VALUE;
         for (byte b : data)
             if (b < min)
@@ -91,55 +138,53 @@
         return min;
     }
 
-    public byte[] getRawData() {
-        return data;
-    }
-
-    public void set(int index, byte value) {
-        data[index] = value;
+    /**
+     * Gets quality values in reverse order
+     *
+     * @return quality values in reverse order
+     */
+    public SequenceQualityPhred reverse() {
+        return new SequenceQualityPhred(reverseTransformQualityStorage(data));
     }
 
-    @Override
-    public SequenceQuality reverse() {
-        return new SequenceQualityPhred(reverceTransformQualityStorage(data));
-    }
-
-    public static byte[] reverceTransformQualityStorage(byte[] quality) {
+    /**
+     * Helper method.
+     */
+    private static byte[] reverseTransformQualityStorage(byte[] quality) {
         byte[] newData = new byte[quality.length];
-        int reverseCoord;
-        for (int coord = 0; coord < quality.length; coord++) {
-            reverseCoord = quality.length - 1 - coord;
+        int reverseCoord = quality.length - 1;
+        for (int coord = 0; coord < quality.length; ++coord, --reverseCoord)
+            //reverseCoord = quality.length - 1 - coord;
             newData[coord] = quality[reverseCoord];
-        }
-        return newData;
-    }
 
-    @Override
-    public void mergeWith(SequenceQuality quality) {
-        if (quality.getBaseClass() != SequenceQualityPhred.class
-                || quality.size() != this.data.length)
-            return;
-        byte q;
-        for (int i = 0; i < data.length; ++i)
-            if (data[i] < (q = quality.rawQualityValue(i)))
-                data[i] = q;
+        assert reverseCoord == -1;
+
+        return newData;
     }
 
-    @Override
+    /**
+     * Returns substring of current quality scores line.
+     *
+     * @param from inclusive
+     * @param to   exclusive
+     * @return substring of current quality scores line
+     */
+    public SequenceQualityPhred getRange(int from, int to) {
+        return new SequenceQualityPhred(Arrays.copyOfRange(data, from, to), true);
+    }
+
+    /**
+     * Returns size of quality array
+     *
+     * @return size of quality array
+     */
     public int size() {
         return data.length;
     }
 
     @Override
     public String toString() {
-        char[] chars = new char[data.length];
-        for (int i = 0; i < data.length; ++i)
-            chars[i] = (char) (33 + data[i]);
-        return new String(chars);
-    }
-
-    public static byte[] getContent(SequenceQualityPhred qualityPhred) {
-        return qualityPhred.data.clone();
+        return encodeToString(33);
     }
 
     @Override
@@ -154,16 +199,77 @@
         return true;
     }
 
-    @Override
-    public byte[] encode(byte offset) {
-        byte[] copy = data.clone();
+    /**
+     * Encodes current quality line with given offset. Common values for offset are 33 and 64.
+     *
+     * @param offset offset
+     * @return bytes encoded quality values
+     */
+    public byte[] encode(int offset) {
+        if (offset < 0 || offset > 70)
+            throw new IllegalArgumentException();
+
+        byte[] copy = new byte[data.length];
         for (int i = copy.length - 1; i >= 0; --i)
-            copy[i] += offset;
+            copy[i] += data[i] + offset;
         return copy;
     }
 
+    /**
+     * Encodes current quality line with given offset. Common values for offset are 33 and 64.
+     *
+     * @param offset offset
+     * @return encoded quality values
+     */
+    public String encodeToString(int offset) {
+        return new String(encode(offset));
+    }
+
     @Override
     public int hashCode() {
-        return Arrays.hashCode(data);
+        return Arrays.hashCode(data) * 31 + 17;
+    }
+
+    /**
+     * Returns a copy of inner byte array.
+     *
+     * @param quality quality
+     * @return values
+     */
+    public static byte[] getContent(SequenceQualityPhred quality) {
+        return quality.data.clone();
+    }
+
+    public static byte[] parse(QualityFormat format, byte[] data, boolean check) {
+        //For performance
+        final byte offset = format.getOffset(), from = format.getMinValue(), to = format.getMaxValue();
+        byte[] res = new byte[data.length];
+        for (int i = 0; i < data.length; i++) {
+            res[i] = (byte) (data[i] - offset);
+
+            if (check &&
+                    (res[i] < from || res[i] > to))
+                throw new WrongQualityStringException(((char) (data[i])) + " [" + res[i] + "]");
+
+            //if (data[i] < qualityCodeFrom)
+            //    if (!lowerUnSafe)
+            //        throw new WrongQualityStringException(((char) (data[i] + qualityCodeOffset)) + " [" + data[i] + "]");
+            //    else
+            //        data[i] = (byte) qualityCodeFrom;
+        }
+        return res;
+    }
+
+    /**
+     * Factory method for the SequenceQualityPhred object. It performs all necessary range checks if required.
+     *
+     * @param format format of encoded quality values
+     * @param data   byte with encoded quality values
+     * @param check  determines whether range check is required
+     * @return quality line object
+     * @throws WrongQualityStringException if encoded value are out of range and checking is enabled
+     */
+    public static SequenceQualityPhred create(QualityFormat format, byte[] data, boolean check) {
+        return new SequenceQualityPhred(parse(format, data, check), true);
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityUtils.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityUtils.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityUtils.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/SequenceQualityUtils.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,33 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequence.quality;
+
+public final class SequenceQualityUtils {
+    public static final byte GOOD_QUALITY_VALUE = (byte) 34;
+    public static final byte BAD_QUALITY_VALUE = (byte) 2;
+
+    private SequenceQualityUtils() {
+    }
+
+    public static SequenceQualityPhred createGoodQualityObject(int length) {
+        return new SequenceQualityPhred(GOOD_QUALITY_VALUE, length);
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/WrongQualityStringException.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/WrongQualityStringException.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/quality/WrongQualityStringException.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/quality/WrongQualityStringException.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,30 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequence.quality;
+
+public class WrongQualityStringException extends RuntimeException {
+    public WrongQualityStringException() {
+    }
+
+    public WrongQualityStringException(String message) {
+        super(message);
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/NucleotideSQPairSet.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/NucleotideSQPairSet.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/NucleotideSQPairSet.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/NucleotideSQPairSet.java	2013-10-09 08:03:10.000000000 +0000
@@ -23,7 +23,6 @@
 
 import com.milaboratory.core.sequence.NucleotideSQPair;
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
 import com.milaboratory.core.sequence.util.SequencesUtils;
 
@@ -45,7 +44,7 @@
     //TODO idea: store {byte[] qual, int counter} to count aggregated sequences
     //TODO and not to remove good sequence if better sequenced PCR-error variant was passed to add() method
     private final float fFactor;
-    private final Map<NucleotideSequenceImpl, byte[]> map = new HashMap<>();
+    private final Map<NucleotideSequence, byte[]> map = new HashMap<>();
 
     /**
      * Main constructor.
@@ -79,7 +78,7 @@
         float t = fFactor * penaltyThreshold;
 
         for (int i = 0; i < pair.size() && t >= 0.0f; ++i)
-            t -= penalty.penalty(40, pair.getQuality().rawQualityValue(i));
+            t -= penalty.penalty(40, pair.getQuality().value(i));
 
         if (t >= 0.0f) {
             //Debug
@@ -91,7 +90,8 @@
         filtered++;
 
         //~ type cast. Only NucleotideSequenceImpl has right implementation for hashCode and equals
-        final NucleotideSequenceImpl sequence = NucleotideSequenceImpl.fromSequence(pair.getSequence());
+        //final NucleotideSequence sequence = NucleotideSequence.fromSequence(pair.getSequence());
+        final NucleotideSequence sequence = pair.getSequence();
 
         //~~~~~~~~~~~~~ Search for exact hit ~~~~~~~~~~~~~
         byte[] qualities = map.get(sequence);
@@ -105,7 +105,7 @@
             //Updating quality values from new sequence
             //Setting "max" quality.
             for (int i = 0; i < qualities.length; ++i)
-                if ((qual = pair.getQuality().rawQualityValue(i)) > qualities[i])
+                if ((qual = pair.getQuality().value(i)) > qualities[i])
                     qualities[i] = qual;
             //This sequence is already in the map, so, return. (No count++ is needed)
             return;
@@ -116,15 +116,15 @@
         boolean found = false;
 
         //Iterating through whole map
-        Iterator<Map.Entry<NucleotideSequenceImpl, byte[]>> it = map.entrySet().iterator(); //Iterator here is used to be abel to remove entries
-        Map.Entry<NucleotideSequenceImpl, byte[]> e;
+        Iterator<Map.Entry<NucleotideSequence, byte[]>> it = map.entrySet().iterator(); //Iterator here is used to be abel to remove entries
+        Map.Entry<NucleotideSequence, byte[]> e;
         while (it.hasNext()) {
             //Getting entry
             e = it.next();
 
             //Extracting quality and sequence
             final byte[] qualsInMap = e.getValue();
-            final NucleotideSequenceImpl sequenceInMap = e.getKey();
+            final NucleotideSequence sequenceInMap = e.getKey();
 
             //Just in case...
             if (qualsInMap.length != sequence.size())
@@ -134,7 +134,7 @@
             p = 0.0f;
             for (int i = 0; i < qualsInMap.length; ++i)
                 if (sequence.codeAt(i) != sequenceInMap.codeAt(i)) {
-                    p += penalty.penalty(qualsInMap[i], pair.getQuality().rawQualityValue(i));
+                    p += penalty.penalty(qualsInMap[i], pair.getQuality().value(i));
                     if (p > penaltyThreshold) //Not a hit, break.
                         break;
                 }
@@ -145,7 +145,7 @@
                 //Who is the best?
                 int sum = 0;
                 for (int i = 0; i < pair.size(); ++i) {
-                    sum += pair.getQuality().rawQualityValue(i);
+                    sum += pair.getQuality().value(i);
                     sum -= e.getValue()[i];
                 }
 
@@ -233,9 +233,9 @@
     }
 
     private static class It implements Iterator<NucleotideSQPair> {
-        private final Iterator<Map.Entry<NucleotideSequenceImpl, byte[]>> innerIt;
+        private final Iterator<Map.Entry<NucleotideSequence, byte[]>> innerIt;
 
-        private It(Iterator<Map.Entry<NucleotideSequenceImpl, byte[]>> innerIt) {
+        private It(Iterator<Map.Entry<NucleotideSequence, byte[]>> innerIt) {
             this.innerIt = innerIt;
         }
 
@@ -246,7 +246,7 @@
 
         @Override
         public NucleotideSQPair next() {
-            Map.Entry<NucleotideSequenceImpl, byte[]> n = innerIt.next();
+            Map.Entry<NucleotideSequence, byte[]> n = innerIt.next();
             return new NucleotideSQPair(n.getKey(), new SequenceQualityPhred(n.getValue()));
         }
 
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/SequenceTreeMap.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/SequenceTreeMap.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/SequenceTreeMap.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/SequenceTreeMap.java	2013-10-09 08:03:10.000000000 +0000
@@ -593,7 +593,7 @@
         }
 
         public S getSequence() {
-            SequenceBuilder builder = alphabet.getSequenceBuilderFactory().create(pointer);
+            SequenceBuilder builder = alphabet.getBuilderFactory().create(pointer);
             for (int i = 0; i < pointer; ++i)
                 builder.setCode(i, wrappers[i].position);
             return (S) builder.create();
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMap.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMap.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMap.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMap.java	2013-10-09 08:03:10.000000000 +0000
@@ -250,14 +250,14 @@
         return new Iterable<Map.Entry<S, T>>() {
             @Override
             public java.util.Iterator<Map.Entry<S, T>> iterator() {
-                return new EntryIterator<T, S>(root, alphabet.getSequenceBuilderFactory());
+                return new EntryIterator<T, S>(root, alphabet.getBuilderFactory());
             }
         };
     }
 
     @Override
     public java.util.Iterator<T> iterator() {
-        return new Iterator<>(new EntryIterator<T, Sequence>(root, alphabet.getSequenceBuilderFactory()));
+        return new Iterator<>(new EntryIterator<T, Sequence>(root, alphabet.getBuilderFactory()));
         //return new Iterator<>(root, alphabet.codesCount());
     }
 
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideRCSequence.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideRCSequence.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideRCSequence.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideRCSequence.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,50 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence.util;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
-import com.milaboratory.util.Bit2Array;
-
-/**
- * Nucleotide reverse complement sequence.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public class NucleotideRCSequence extends NucleotideSequenceImpl {
-    private NucleotideSequence originalSequence;
-
-    public NucleotideRCSequence(NucleotideSequence originalSequence) {
-        super(transformNucleotideStorage(originalSequence));
-        this.originalSequence = originalSequence;
-    }
-
-    private static Bit2Array transformNucleotideStorage(NucleotideSequence sequence) {
-        Bit2Array newData = new Bit2Array(sequence.size());
-        int reverseCoord;
-        for (int coord = 0; coord < sequence.size(); coord++) {
-            reverseCoord = sequence.size() - 1 - coord;
-            newData.set(coord, (~sequence.codeAt(reverseCoord)) & 0x3);
-        }
-        return newData;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregator.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregator.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregator.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregator.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,120 @@
+package com.milaboratory.core.sequence.util;
+
+import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
+import com.milaboratory.util.Bit2Array;
+
+public class NucleotideSequenceAggregator {
+    final long[] observations;
+    long sequences = 0;
+    final int length, delta;
+
+    public NucleotideSequenceAggregator(int length, int delta) {
+        this.observations = new long[(length + 2 * delta) * 4];
+        this.length = length;
+        this.delta = delta;
+    }
+
+    public long getObservations(int position, int code) {
+        if (code < 0 || code >= 4 || position < 0 || position >= length + 2 * delta)
+            throw new IllegalArgumentException();
+
+        return observations[position * 4 + code];
+    }
+
+    private long getScore(NucleotideSequence sequence, int d) {
+        long result = 0;
+
+        for (int i = sequence.size() - 1; i >= 0; --i)
+            result += observations[(delta + i + d) * 4 + sequence.codeAt(i)];
+
+        return result;
+    }
+
+    public long getSequences() {
+        return sequences;
+    }
+
+    private void putSequence(NucleotideSequence sequence, int d) {
+        ++sequences;
+        for (int i = sequence.size() - 1; i >= 0; --i)
+            ++observations[(delta + i + d) * 4 + sequence.codeAt(i)];
+    }
+
+    public void putSequence(NucleotideSequence sequence) {
+        if (sequence.size() != length)
+            throw new IllegalArgumentException();
+
+        if (sequences == 0) {
+            putSequence(sequence, 0);
+            return;
+        }
+
+        int maxD = 0;
+        long maxScore = getScore(sequence, 0), score;
+
+        for (int d = 1; d <= delta; ++d) {
+            if ((score = getScore(sequence, d)) > maxScore) {
+                maxScore = score;
+                maxD = d;
+            }
+            if ((score = getScore(sequence, -d)) > maxScore) {
+                maxScore = score;
+                maxD = -d;
+            }
+        }
+
+        putSequence(sequence, maxD);
+    }
+
+    public NucleotideSequence getSequence(double minPercent) {
+        int start = 0, end = 0, lastBad = -1;
+        byte maxCode, code;
+        long maxCount, sum;
+        double percent;
+
+        for (int i = 0; i < length + delta * 2; ++i) {
+            //maxCode = -1;
+            maxCount = 0;
+            sum = 0;
+
+            for (code = 0; code < 4; ++code) {
+                sum += observations[i * 4 + code];
+                if (maxCount < observations[i * 4 + code]) {
+                    maxCount = observations[i * 4 + code];
+                    //maxCode = code;
+                }
+            }
+
+            if (sum == 0) {
+                lastBad = i;
+                continue;
+            }
+
+            percent = 1.0 * maxCount / sum;
+
+            if (percent < minPercent)
+                lastBad = i;
+            else if (end - start < i - lastBad) {
+                end = i + 1;
+                start = lastBad + 1;
+            }
+        }
+
+        Bit2Array st = new Bit2Array(end - start);
+
+        for (int i = start; i < end; ++i) {
+            maxCode = -1;
+            maxCount = 0;
+
+            for (code = 0; code < 4; ++code)
+                if (maxCount < observations[i * 4 + code]) {
+                    maxCount = observations[i * 4 + code];
+                    maxCode = code;
+                }
+
+            st.set(i - start, maxCode);
+        }
+
+        return NucleotideSequence.fromStorage(st);
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceGenerator.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceGenerator.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceGenerator.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSequenceGenerator.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,7 +21,6 @@
 package com.milaboratory.core.sequence.util;
 
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.util.Bit2Array;
 
 public class NucleotideSequenceGenerator {
@@ -33,7 +32,7 @@
         byte[] data = new byte[stSize];
         for (int i = 0; i < count; ++i) {
             Bit2Array st = Bit2Array.construct(length, data.clone());
-            result[i] = NucleotideSequenceImpl.fromStorage(st);
+            result[i] = new NucleotideSequence(st);
 
             data[data.length - 1]++;
             for (int j = data.length - 2; j >= 0; --j)
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSubSequence.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSubSequence.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/NucleotideSubSequence.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/NucleotideSubSequence.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,76 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence.util;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-
-/**
- * Nucleotide sub sequence adapter. Implements all NucleotideSequence methods.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public class NucleotideSubSequence extends NucleotideSequence {
-    private final NucleotideSequence sequence;
-    private final int from, length;
-
-    public NucleotideSubSequence(NucleotideSequence sequence, int from, int length) {
-        if (from < 0 || from >= sequence.size() || length < 0 || from + length > sequence.size())
-            throw new IllegalArgumentException();
-        this.sequence = sequence;
-        this.from = from;
-        this.length = length;
-    }
-
-    /**
-     * Till the end of sequence.
-     *
-     * @param sequence
-     * @param from
-     */
-    public NucleotideSubSequence(NucleotideSequence sequence, int from) {
-        this(sequence, from, sequence.size() - from);
-    }
-
-    @Override
-    public byte codeAt(int position) {
-        if (position < 0 || position >= length)
-            throw new IndexOutOfBoundsException();
-        return sequence.codeAt(from + position);
-    }
-
-    @Override
-    public int size() {
-        return length;
-    }
-
-    public int getTo() {
-        return from + length;
-    }
-
-    public NucleotideSequence getInnerSequence() {
-        return sequence;
-    }
-
-    public int getFrom() {
-        return from;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SequenceQualityUtils.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SequenceQualityUtils.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SequenceQualityUtils.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SequenceQualityUtils.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,43 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence.util;
-
-import com.milaboratory.core.sequence.SequenceQuality;
-import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
-
-public final class SequenceQualityUtils {
-    private SequenceQualityUtils() {
-    }
-
-    public static SequenceQualityPhred getGoodQualityObject(int length) {
-        return new SequenceQualityPhred(SequenceQuality.Constants.goodQuality, length);
-    }
-
-    public static SequenceQuality copy(SequenceQuality qulity) {
-        if (qulity.getBaseClass() == SequenceQualityPhred.class) {
-            byte[] storage = new byte[qulity.size()];
-            for (int i = 0; i < qulity.size(); ++i)
-                storage[i] = qulity.rawQualityValue(i);
-            return new SequenceQualityPhred(storage);
-        }
-        throw new RuntimeException("Unsupported quality type");
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SequencesUtils.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SequencesUtils.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SequencesUtils.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SequencesUtils.java	2013-10-09 08:03:10.000000000 +0000
@@ -23,8 +23,6 @@
 import com.milaboratory.core.sequence.Alphabet;
 import com.milaboratory.core.sequence.Sequence;
 import com.milaboratory.core.sequence.SequenceBuilder;
-import com.milaboratory.core.sequence.SequenceQuality;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
 import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
 
 import java.util.ArrayList;
@@ -89,16 +87,17 @@
         return result;
     }
 
-    public static byte[] extractRawQualityValues(SequenceQuality quality) {
+    public static byte[] extractRawQualityValues(SequenceQualityPhred quality) {
         if (quality instanceof SequenceQualityPhred)
-            return SequenceQualityPhred.getContent((SequenceQualityPhred) quality);
+            return SequenceQualityPhred.getContent(quality);
+        //TODO <----
         byte[] values = new byte[quality.size()];
         for (int i = 0; i < values.length; ++i)
-            values[i] = quality.rawQualityValue(i);
+            values[i] = quality.value(i);
         return values;
     }
 
-    /**
+    /*
      * A factory method of NucleotideSubSequence class. If sub-sequence coords lies out of target sequence it returns
      * null.
      *
@@ -107,14 +106,14 @@
      * @param length   length of subsequence
      * @return null or NucleotideSubSequence.
      */
-    public static NucleotideSubSequence getSubSequence(NucleotideSequence sequence, int from, int length) {
-        if (from < 0 || from + length > sequence.size())
-            return null;
-        return new NucleotideSubSequence(sequence, from, length);
-    }
+    //public static NucleotideSubSequence getSubSequence(NucleotideSequence sequence, int from, int length) {
+    //    if (from < 0 || from + length > sequence.size())
+    //        return null;
+    //    return new NucleotideSubSequence(sequence, from, length);
+    //}
 
 
-    /**
+    /*
      * A factory method of NucleotideSubSequence class. If sub-sequence coords lies out of target sequence it returns
      * null.
      *
@@ -122,11 +121,11 @@
      * @param from     from coordinate
      * @return null or NucleotideSubSequence.
      */
-    public static NucleotideSubSequence getSubSequence(NucleotideSequence sequence, int from) {
-        if (from < 0 || from > sequence.size() - 1)
-            return null;
-        return new NucleotideSubSequence(sequence, from, sequence.size() - from);
-    }
+    //public static NucleotideSubSequence getSubSequence(NucleotideSequence sequence, int from) {
+    //    if (from < 0 || from > sequence.size() - 1)
+    //        return null;
+    //    return new NucleotideSubSequence(sequence, from, sequence.size() - from);
+    //}
 
     public static <S extends Sequence> S cat(S... sequences) {
         if (sequences.length == 0)
@@ -139,7 +138,7 @@
         for (S s : sequences)
             size += s.size();
 
-        SequenceBuilder<S> builder = sequences[0].getAlphabet().getSequenceBuilderFactory().create(size);
+        SequenceBuilder<S> builder = sequences[0].getAlphabet().getBuilderFactory().create(size);
         int pointer = 0;
         for (S s : sequences) {
             builder.copyFrom(s, 0, pointer, s.size());
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SubSequenceQuality.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SubSequenceQuality.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequence/util/SubSequenceQuality.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequence/util/SubSequenceQuality.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,117 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequence.util;
-
-import com.milaboratory.core.sequence.SequenceQuality;
-import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
-
-import java.util.Arrays;
-
-/**
- * Sub sequence quality object.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public class SubSequenceQuality implements SequenceQuality {
-    private SequenceQuality quality;
-    private int from, length;
-
-    public SubSequenceQuality(SequenceQuality quality, int from, int length) {
-        this.quality = quality;
-        this.from = from;
-        this.length = length;
-    }
-
-    @Override
-    public byte[] encode(byte offset) {
-        throw new UnsupportedOperationException();
-    }
-
-    @Override
-    public byte rawQualityValue(int coord) {
-        if (coord < 0 || coord >= length)
-            throw new IndexOutOfBoundsException();
-        return quality.rawQualityValue(coord + from);
-    }
-
-    @Override
-    public byte minRawQuality() {
-        byte min = Byte.MAX_VALUE;
-        for (int i = 0; i < length; ++i)
-            if (quality.rawQualityValue(i + from) < min)
-                min = quality.rawQualityValue(i + from);
-        return min;
-    }
-
-    @Override
-    public float probabilityOfErrorAt(int coord) {
-        if (coord < 0 || coord >= length)
-            throw new IndexOutOfBoundsException();
-        return quality.probabilityOfErrorAt(coord + from);
-    }
-
-    @Override
-    public float log10ProbabilityOfErrorAt(int coord) {
-        if (coord < 0 || coord >= length)
-            throw new IndexOutOfBoundsException();
-        return quality.log10ProbabilityOfErrorAt(coord + from);
-    }
-
-    public SequenceQuality getInnerSequenceQuality() {
-        return quality;
-    }
-
-    public int getFrom() {
-        return from;
-    }
-
-    @Override
-    public void mergeWith(SequenceQuality quality) {
-        throw new UnsupportedOperationException("Not supported yet.");
-    }
-
-    @Override
-    public void setRawQualityValue(int coord, byte value) {
-        throw new UnsupportedOperationException("Not supported yet.");
-    }
-
-    @Override
-    public Class<? extends SequenceQuality> getBaseClass() {
-        return quality.getBaseClass();
-    }
-
-    @Override
-    public int size() {
-        return length;
-    }
-
-    public SequenceQuality toNativeQualityObject() {
-        if (quality instanceof SequenceQualityPhred)
-            return new SequenceQualityPhred(Arrays.copyOfRange(((SequenceQualityPhred) quality).getRawData(), from, from + length));
-        throw new UnsupportedOperationException();
-    }
-
-    @Override
-    public SequenceQuality reverse() {
-        return new SubSequenceQuality(quality.reverse(), quality.size() - from - length, length);
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fasta/FastaReader.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fasta/FastaReader.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fasta/FastaReader.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fasta/FastaReader.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,11 +22,9 @@
 
 import cc.redberry.pipe.blocks.AbstractOutputPortUninterruptible;
 import com.milaboratory.core.sequence.NucleotideSQPair;
-import com.milaboratory.core.sequence.SequenceQuality;
 import com.milaboratory.core.sequence.nucleotide.NucleotideAlphabetWithN;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
+import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
 import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
-import com.milaboratory.core.sequence.util.SequenceQualityUtils;
 import com.milaboratory.core.sequencing.io.SSequencingDataReader;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
 import com.milaboratory.core.sequencing.read.SSequencingReadImpl;
@@ -36,6 +34,10 @@
 import java.io.FileInputStream;
 import java.io.FileNotFoundException;
 import java.io.IOException;
+import java.util.Arrays;
+
+import static com.milaboratory.core.sequence.quality.SequenceQualityUtils.BAD_QUALITY_VALUE;
+import static com.milaboratory.core.sequence.quality.SequenceQualityUtils.GOOD_QUALITY_VALUE;
 
 /**
  * Reads sequences from a FASTA file
@@ -94,20 +96,22 @@
 
         char[] chars = item.getSequence();
         //No quality in FAST format, so use good string
-        SequenceQualityPhred quality = SequenceQualityUtils.getGoodQualityObject(chars.length);//new SequenceQualityPhred(SequenceQuality.Constants.goodQuality, chars.length);
+        //SequenceQualityPhred quality = SequenceQualityUtils.createGoodQualityObject(chars.length);//new SequenceQualityPhred(SequenceQuality.Constants.goodQuality, chars.length);
+        byte[] quality = new byte[chars.length];
+        Arrays.fill(quality, GOOD_QUALITY_VALUE);
         Bit2Array seqData = new Bit2Array(chars.length);
         for (int i = 0; i < chars.length; ++i) {
             byte base = NucleotideAlphabetWithN.INSTANCE.codeFromSymbol(chars[i]);
             if (base == 4)
                 //The letter will be "A"
-                quality.set(i, SequenceQuality.Constants.badQuality);
+                quality[i] = BAD_QUALITY_VALUE;
             else
                 seqData.set(i, base);
         }
         //setPercentRed();
         return new SSequencingReadImpl(item.getDescription(),
-                new NucleotideSQPair(NucleotideSequenceImpl.fromStorage(seqData),
-                        quality), id);
+                new NucleotideSQPair(new NucleotideSequence(seqData),
+                        new SequenceQualityPhred(quality)), id);
     }
 
     /*public void setPercentRed() {
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/Casava18InfoProvider.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/Casava18InfoProvider.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/Casava18InfoProvider.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/Casava18InfoProvider.java	2013-10-09 08:03:10.000000000 +0000
@@ -23,12 +23,12 @@
 /**
  * Parses read metadata from Casava18 formatted header
  */
-public class Casava18InfoProvider implements IlluminaInfoProvider {
+public class Casava18InfoProvider implements ReadInfoProvider {
     // HWUSI-EAS1814:40:1:4:9:1523:931 1:N:0:TGACCA
     @Override
-    public IlluminaReadInfo getInfo(String description) {
+    public ReadInfo getInfo(String description) {
         String[] split0 = description.split(" ");
         String[] split1 = split0[1].split(":");
-        return new IlluminaReadInfoImpl(split0[0], (byte) (Byte.parseByte(split1[0], 10) - 1), split1[1].equals("Y"));
+        return new ReadInfoImpl(split0[0], (byte) (Byte.parseByte(split1[0], 10) - 1), split1[1].equals("Y"));
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProvider.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProvider.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProvider.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProvider.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,25 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq;
-
-public interface IlluminaInfoProvider {
-    IlluminaReadInfo getInfo(String description);
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProviderFactory.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProviderFactory.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProviderFactory.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaInfoProviderFactory.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,33 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq;
-
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
-
-public class IlluminaInfoProviderFactory {
-    public static IlluminaInfoProvider createProvider(QualityStringFormat format) {
-        switch (format) {
-            case Illumina18:
-                return new Casava18InfoProvider();
-        }
-        throw new RuntimeException("ReadInfoProvider not implemented for this FASTQ format.");
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfo.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfo.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfo.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfo.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,55 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq;
-
-/**
- * An interface for read metadata in Illumina format
- */
-public interface IlluminaReadInfo {
-    /**
-     * Order of the read in paired data
-     *
-     * @return {@code 0} for first read, {@code 1} for second read
-     */
-    byte getReadNumber();
-
-    /**
-     * Checks if this read is a mate of another one
-     *
-     * @param other other read to compare
-     * @return {@code true} if reads are paired, {@code false} otherwise
-     */
-    boolean isPairOf(IlluminaReadInfo other);
-
-    /**
-     * Checks if read is filtered (i.e. should be omitted)
-     *
-     * @return {@code true} if read is filtered, {@code false} otherwise
-     */
-    boolean isFiltered();
-
-    /**
-     * Gets the description for read
-     *
-     * @return the description for read
-     */
-    String pDescription();
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfoImpl.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfoImpl.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfoImpl.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/IlluminaReadInfoImpl.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,78 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq;
-
-/**
- * An implementation of {@link IlluminaReadInfo}
- */
-public class IlluminaReadInfoImpl implements IlluminaReadInfo {
-    private final String pairId;
-    private final byte readNumber;
-    private final boolean isFiltered;
-
-    /**
-     * Creates a container holding read metadata
-     *
-     * @param pairId     id of read pair
-     * @param readNumber number of the read
-     * @param filtered   is the read filtered
-     */
-    public IlluminaReadInfoImpl(String pairId, byte readNumber, boolean filtered) {
-        this.pairId = pairId;
-        this.readNumber = readNumber;
-        this.isFiltered = filtered;
-    }
-
-    @Override
-    /**
-     * {@inheritDoc}
-     */
-    public byte getReadNumber() {
-        return readNumber;
-    }
-
-    @Override
-    /**
-     * {@inheritDoc}
-     */
-    public boolean isPairOf(IlluminaReadInfo other) {
-        if (other.getClass() != IlluminaReadInfoImpl.class)
-            return false;
-        IlluminaReadInfoImpl impl = (IlluminaReadInfoImpl) other;
-        return impl.pairId.equals(this.pairId) && (1 - this.readNumber) == (impl.readNumber);
-    }
-
-    @Override
-    /**
-     * {@inheritDoc}
-     */
-    public boolean isFiltered() {
-        return isFiltered;
-    }
-
-    @Override
-    /**
-     * {@inheritDoc}
-     */
-    public String pDescription() {
-        return pairId;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/NucleotideSQPairTrimmer.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/NucleotideSQPairTrimmer.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/NucleotideSQPairTrimmer.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/NucleotideSQPairTrimmer.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,8 +22,7 @@
 
 import cc.redberry.pipe.Processor;
 import com.milaboratory.core.sequence.NucleotideSQPair;
-import com.milaboratory.core.sequence.SequenceQuality;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
 
 /**
  * Trims bad quality nucleotides from {@link NucleotideSQPair}s
@@ -31,26 +30,21 @@
  * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
  */
 public class NucleotideSQPairTrimmer implements Processor<NucleotideSQPair, NucleotideSQPair> {
-    private QualityStringFormat format;
+    private byte thresholdValue;
 
-    /**
-     * Creates bad quality trimmer
-     *
-     * @param format sequencing quality format
-     */
-    public NucleotideSQPairTrimmer(QualityStringFormat format) {
-        this.format = format;
+    public NucleotideSQPairTrimmer(byte thresholdValue) {
+        this.thresholdValue = thresholdValue;
     }
 
     @Override
     public NucleotideSQPair process(NucleotideSQPair input) {
-        SequenceQuality quality = input.getQuality();
+        SequenceQualityPhred quality = input.getQuality();
         int trimTo = quality.size() - 1;
         for (int i = quality.size() - 1; i >= 0; --i)
-            if (quality.rawQualityValue(i) != format.getZeroQualityValue())
+            if (quality.value(i) <= thresholdValue)
                 break;
             else
                 trimTo = i;
-        return input.getSubPairCopy(0, trimTo).getDeepCopy();
+        return input.getRange(0, trimTo);
     }
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqReader.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqReader.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqReader.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqReader.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,8 +21,8 @@
 package com.milaboratory.core.sequencing.io.fastq;
 
 import cc.redberry.pipe.blocks.AbstractOutputPortUninterruptible;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.io.PSequencingDataReader;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
 import com.milaboratory.core.sequencing.read.PSequencingRead;
 import com.milaboratory.core.sequencing.read.PSequencingReadImpl;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
@@ -39,22 +39,27 @@
 // TODO: _close() and _take()
 public class PFastqReader extends AbstractOutputPortUninterruptible<PSequencingRead> implements PSequencingDataReader {
     private final BufferedReader[] readers;
-    private final QualityStringFormat format;
-    private final IlluminaInfoProvider infoProvider;
+    private final QualityFormat format;
+    private final ReadInfoProvider infoProvider;
     private long counter = 0;
     private final boolean notFilteredOnly, check;
 
-    /*public PFastqReader(String file0, String file1, QualityStringFormat format, boolean notFilteredOnly) throws FileNotFoundException {
-    this(file0, file1, format, CompressionType.None, notFilteredOnly);
+    //TODO docs....
+    public PFastqReader(String file0, String file1, QualityFormat format) throws IOException {
+        this(file0, file1, format, CompressionType.None);
     }
 
-    public PFastqReader(String file0, String file1, QualityStringFormat format, CompressionType ct, boolean notFilteredOnly) throws FileNotFoundException {
-    this(new File(file0), new File(file1), format, ct, notFilteredOnly);
+    public PFastqReader(String file0, String file1, QualityFormat format, CompressionType ct) throws IOException {
+        this(new File(file0), new File(file1), format, ct, null, false, false);
     }
 
-    public PFastqReader(File file0, File file1, QualityStringFormat format, boolean notFilteredOnly) throws FileNotFoundException {
-    this(file0, file1, format, CompressionType.None, notFilteredOnly);
-    }*/
+    public PFastqReader(File file0, File file1, QualityFormat format) throws IOException {
+        this(file0, file1, format, CompressionType.None);
+    }
+
+    public PFastqReader(File file0, File file1, QualityFormat format, CompressionType ct) throws IOException {
+        this(file0, file1, format, ct, null, false, false);
+    }
 
     /**
      * Creates a {@link PSequencingRead} stream from two FASTQ files with paired-end read data
@@ -67,8 +72,10 @@
      * @param notFilteredOnly outputs only reads that are not marked by 'filtered' flag in their header
      * @throws IOException in case there is problem with reading from files
      */
-    public PFastqReader(File file0, File file1, QualityStringFormat format, CompressionType ct, boolean check, boolean notFilteredOnly) throws IOException {
-        this(new FileInputStream(file0), new FileInputStream(file1), format, ct, check, notFilteredOnly);
+    public PFastqReader(File file0, File file1, QualityFormat format, CompressionType ct,
+                        ReadInfoProvider infoProvider,
+                        boolean check, boolean notFilteredOnly) throws IOException {
+        this(new FileInputStream(file0), new FileInputStream(file1), format, ct, infoProvider, check, notFilteredOnly);
     }
 
     /**
@@ -82,17 +89,20 @@
      * @param notFilteredOnly outputs only reads that are not marked by 'filtered' flag in their header
      * @throws IOException in case there is problem with reading from files
      */
-    public PFastqReader(InputStream stream0, InputStream stream1, QualityStringFormat format, CompressionType ct, boolean check, boolean notFilteredOnly) throws IOException {
+    public PFastqReader(InputStream stream0, InputStream stream1, QualityFormat format, CompressionType ct,
+                        ReadInfoProvider infoProvider,
+                        boolean check, boolean notFilteredOnly) throws IOException {
         this.readers = new BufferedReader[]{
                 new BufferedReader(new InputStreamReader(ct.createInputStream(stream0))),
                 new BufferedReader(new InputStreamReader(ct.createInputStream(stream1)))
         };
         this.format = format;
+
+        if (infoProvider == null && (check || notFilteredOnly))
+            throw new IllegalArgumentException("Read info provider is required for filtering checking and reads pair errors detection.");
+
+        this.infoProvider = infoProvider;
         this.check = check;
-        if (check || notFilteredOnly)
-            infoProvider = IlluminaInfoProviderFactory.createProvider(format);
-        else
-            infoProvider = null;
         this.notFilteredOnly = notFilteredOnly;
     }
 
@@ -124,8 +134,8 @@
 
             if (check || notFilteredOnly) {
                 //Creating info
-                IlluminaReadInfo info0 = infoProvider.getInfo(read0.getDescription());
-                IlluminaReadInfo info1 = infoProvider.getInfo(read1.getDescription());
+                ReadInfo info0 = infoProvider.getInfo(read0.getDescription());
+                ReadInfo info1 = infoProvider.getInfo(read1.getDescription());
 
                 if (check) {
                     //Correct reads number and pairing
@@ -178,13 +188,13 @@
     }*/
 
     //TODO move to some util class
-    /*public static OutputPort<PSequencingRead> fromFolderSingleRun(String folder, QualityStringFormat
+    /*public static OutputPort<PSequencingRead> fromFolderSingleRun(String folder, QualityFormat
             format, CompressionType ct,
                                                                   boolean notFiltered, boolean trim) {
         return fromFolderSingleRun(new File(folder), format, ct, notFiltered, trim);
     }
 
-    public static OutputPort<PSequencingRead> fromFolderSingleRun(File folder, QualityStringFormat
+    public static OutputPort<PSequencingRead> fromFolderSingleRun(File folder, QualityFormat
             format, CompressionType ct,
                                                                   boolean notFiltered, boolean trim) {
         Pattern pattern = Pattern.compile("R(\\d)_(\\d{3})\\.fastq(.*)");
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqWriter.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqWriter.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqWriter.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PFastqWriter.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,7 +21,7 @@
 
 package com.milaboratory.core.sequencing.io.fastq;
 
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.read.PSequencingRead;
 import com.milaboratory.util.CompressionType;
 
@@ -40,7 +40,7 @@
      * @param fileR2 file to store second read
      * @param format sequencing quality format
      */
-    public PFastqWriter(String fileR1, String fileR2, QualityStringFormat format) throws IOException {
+    public PFastqWriter(String fileR1, String fileR2, QualityFormat format) throws IOException {
         this.writer0 = new SFastqWriter(fileR1, format);
         this.writer1 = new SFastqWriter(fileR2, format);
     }
@@ -53,7 +53,7 @@
      * @param format sequencing quality format
      * @param ct     compression type to use
      */
-    public PFastqWriter(String fileR1, String fileR2, QualityStringFormat format, CompressionType ct) throws IOException {
+    public PFastqWriter(String fileR1, String fileR2, QualityFormat format, CompressionType ct) throws IOException {
         this.writer0 = new SFastqWriter(fileR1, format, ct);
         this.writer1 = new SFastqWriter(fileR2, format, ct);
     }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PSequencingReadsTrimmer.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PSequencingReadsTrimmer.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/PSequencingReadsTrimmer.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/PSequencingReadsTrimmer.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,7 +21,7 @@
 package com.milaboratory.core.sequencing.io.fastq;
 
 import cc.redberry.pipe.Processor;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.read.PSequencingRead;
 import com.milaboratory.core.sequencing.read.PSequencingReadImpl;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
@@ -39,8 +39,8 @@
      *
      * @param format sequencing quality format
      */
-    public PSequencingReadsTrimmer(QualityStringFormat format) {
-        this.trimmer = new NucleotideSQPairTrimmer(format);
+    public PSequencingReadsTrimmer(QualityFormat format) {
+        this.trimmer = new NucleotideSQPairTrimmer((byte) 2);
     }
 
     @Override
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatChecker.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatChecker.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatChecker.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatChecker.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,62 @@
+package com.milaboratory.core.sequencing.io.fastq;
+
+import com.milaboratory.core.sequence.quality.QualityFormat;
+
+import java.io.BufferedReader;
+import java.io.IOException;
+
+import static com.milaboratory.core.sequence.quality.QualityFormat.Phred33;
+import static com.milaboratory.core.sequence.quality.QualityFormat.Phred64;
+
+/**
+ * This class contains methods to infer quality string format from FASTQ data.
+ */
+public final class QualityFormatChecker {
+    public static QualityFormat guessFormat(BufferedReader reader, int maxBytes) throws IOException {
+        String line;
+        int k, chr;
+        boolean signal33, signal64;
+        int maxReadSize = 0, currentReadSize;
+        do {
+            currentReadSize = 0;
+
+            for (k = 0; k < 3; ++k)
+                if ((line = reader.readLine()) != null)
+                    currentReadSize += line.length() + 2;
+                else
+                    return null;
+
+            line = reader.readLine();
+            if (line == null)
+                return null;
+            currentReadSize += line.length() + 2;
+
+            signal33 = false;
+            signal64 = false;
+
+            for (k = line.length() - 1; k >= 0; --k) {
+                chr = (int) line.charAt(k);
+                signal33 |= (chr - 64) < Phred64.getMinValue();
+                signal64 |= (chr - 33) > Phred33.getMaxValue();
+            }
+
+            //The file has bad format.
+            //If any of formats is applicable file contains out of range values in any way.
+            if (signal33 && signal64)
+                return null;
+
+            if (signal33)
+                return Phred33;
+            if (signal64)
+                return Phred64;
+
+            maxBytes -= currentReadSize;
+
+            if (maxReadSize < currentReadSize)
+                maxReadSize = currentReadSize;
+
+        } while (maxBytes - maxReadSize > 0); //Weak condition if file contains reads with different read lengths
+
+        return null;
+    }
+}
\ No newline at end of file
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatGuesser.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatGuesser.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatGuesser.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/QualityFormatGuesser.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,63 +0,0 @@
-package com.milaboratory.core.sequencing.io.fastq;
-
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
-
-import java.io.BufferedReader;
-import java.io.IOException;
-
-/**
- * This class contains methods to infer quality string format from FASTQ data.
- */
-public class QualityFormatGuesser {
-    /**
-     * According to Wikipedia maximal quality is 41 for Illumina 1.8+ format 2 is added just in case.
-     */
-    private static final int MAX_QUALITY = 43;
-    private static final int MIN_QUALITY = -5;
-
-    public static QualityStringFormat guessFormat(BufferedReader reader, int maxBytes) throws IOException {
-        String line;
-        int k, chr;
-        boolean signal33, signal64;
-        int maxReadSize = 0, readSize;
-        do {
-            readSize = 0;
-
-            for (k = 0; k < 3; ++k)
-                if ((line = reader.readLine()) != null)
-                    readSize += line.length() + 2;
-                else
-                    return null;
-
-            line = reader.readLine();
-            if (line == null)
-                return null;
-            readSize += line.length() + 2;
-
-            signal33 = false;
-            signal64 = false;
-
-            for (k = line.length() - 1; k >= 0; --k) {
-                chr = (int) line.charAt(k);
-                signal33 |= (chr - 64) < MIN_QUALITY;
-                signal64 |= (chr - 33) > MAX_QUALITY;
-            }
-
-            if (signal33 && signal64)
-                return null;
-
-            if (signal33)
-                return QualityStringFormat.Illumina18u;
-            if (signal64)
-                return QualityStringFormat.Illumina15;
-
-            maxBytes -= readSize;
-
-            if (maxReadSize < readSize)
-                maxReadSize = readSize;
-
-        } while (maxBytes - maxReadSize > 0);
-
-        return null;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfo.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfo.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfo.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfo.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,55 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequencing.io.fastq;
+
+/**
+ * An interface for read metadata in Illumina format
+ */
+public interface ReadInfo {
+    /**
+     * Order of the read in paired data
+     *
+     * @return {@code 0} for first read, {@code 1} for second read
+     */
+    byte getReadNumber();
+
+    /**
+     * Checks if this read is a mate of another one
+     *
+     * @param other other read to compare
+     * @return {@code true} if reads are paired, {@code false} otherwise
+     */
+    boolean isPairOf(ReadInfo other);
+
+    /**
+     * Checks if read is filtered (i.e. should be omitted)
+     *
+     * @return {@code true} if read is filtered, {@code false} otherwise
+     */
+    boolean isFiltered();
+
+    /**
+     * Gets the description for read
+     *
+     * @return the description for read
+     */
+    String pDescription();
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoImpl.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoImpl.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoImpl.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoImpl.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,78 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequencing.io.fastq;
+
+/**
+ * An implementation of {@link ReadInfo}
+ */
+public class ReadInfoImpl implements ReadInfo {
+    private final String pairId;
+    private final byte readNumber;
+    private final boolean isFiltered;
+
+    /**
+     * Creates a container holding read metadata
+     *
+     * @param pairId     id of read pair
+     * @param readNumber number of the read
+     * @param filtered   is the read filtered
+     */
+    public ReadInfoImpl(String pairId, byte readNumber, boolean filtered) {
+        this.pairId = pairId;
+        this.readNumber = readNumber;
+        this.isFiltered = filtered;
+    }
+
+    @Override
+    /**
+     * {@inheritDoc}
+     */
+    public byte getReadNumber() {
+        return readNumber;
+    }
+
+    @Override
+    /**
+     * {@inheritDoc}
+     */
+    public boolean isPairOf(ReadInfo other) {
+        if (other.getClass() != ReadInfoImpl.class)
+            return false;
+        ReadInfoImpl impl = (ReadInfoImpl) other;
+        return impl.pairId.equals(this.pairId) && (1 - this.readNumber) == (impl.readNumber);
+    }
+
+    @Override
+    /**
+     * {@inheritDoc}
+     */
+    public boolean isFiltered() {
+        return isFiltered;
+    }
+
+    @Override
+    /**
+     * {@inheritDoc}
+     */
+    public String pDescription() {
+        return pairId;
+    }
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoProvider.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoProvider.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoProvider.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/ReadInfoProvider.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,25 @@
+/*
+ * MiTCR <http://milaboratory.com>
+ *
+ * Copyright (c) 2010-2013:
+ *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
+ *     Chudakov Dmitriy    <chudakovdm@mail.ru>
+ *
+ * MiTCR is free software: you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License as published by the Free
+ * Software Foundation, either version 3 of the License, or (at your option)
+ * any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
+ * more details.
+ *
+ * You should have received a copy of the GNU General Public License along
+ * with this program. If not, see <http://www.gnu.org/licenses/>.
+ */
+package com.milaboratory.core.sequencing.io.fastq;
+
+public interface ReadInfoProvider {
+    ReadInfo getInfo(String description);
+}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqReader.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqReader.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqReader.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqReader.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,12 +22,12 @@
 
 import cc.redberry.pipe.blocks.AbstractOutputPortUninterruptible;
 import com.milaboratory.core.sequence.NucleotideSQPair;
-import com.milaboratory.core.sequence.SequenceQuality;
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
+import com.milaboratory.core.sequence.quality.QualityFormat;
+import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
+import com.milaboratory.core.sequence.quality.SequenceQualityUtils;
+import com.milaboratory.core.sequence.quality.WrongQualityStringException;
 import com.milaboratory.core.sequencing.io.SSequencingDataReader;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
-import com.milaboratory.core.sequencing.io.fastq.quality.WrongQualityStringException;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
 import com.milaboratory.core.sequencing.read.SSequencingReadImpl;
 import com.milaboratory.util.CanReportProgress;
@@ -35,7 +35,6 @@
 import com.milaboratory.util.CountingInputStream;
 
 import java.io.*;
-import java.util.concurrent.atomic.AtomicLong;
 
 /**
  * FASTQ files reader, using BufferedReader.readLine() method.
@@ -45,111 +44,75 @@
  */
 // TODO: _close() and _take()
 public class SFastqReader extends AbstractOutputPortUninterruptible<SSequencingRead> implements SSequencingDataReader, CanReportProgress {
+    private static final int BUFFER_SIZE = 32768;
+
     //Main Input
     private final BufferedReader reader;
-    //To determine red percent
-    //private final FileChannel channel;
-    //private volatile int percentRed = 0;
-    private final AtomicLong dotCorrections = new AtomicLong();
+    //The total size of input stream if known.
     private final long totalSize;
+    //Reads read
     private long counter = 0;
-    //FASTQ format
+    //Bytes read counting IS
     private final CountingInputStream countingStream;
-    private final QualityStringFormat format;
-    private final IlluminaInfoProvider infoProvider;
+    //FASTQ format
+    private final QualityFormat format;
+    private final ReadInfoProvider infoProvider;
     //private final boolean notFilteredOnly;
 
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param stream          stream with reads
-     * @param format          read quality encoding format
-     * @param ct              type of compression (NONE, GZIP, etc)
-     * @param notFilteredOnly outputs only reads that are not marked by 'filtered' flag in their header
+     * @param file file with reads
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(InputStream stream, QualityStringFormat format, CompressionType ct, boolean notFilteredOnly) throws IOException {
-        this(stream, format, ct, notFilteredOnly, false);
+    public SFastqReader(String file) throws IOException {
+        this(new FileInputStream(file), null, file.endsWith(".gz") ? CompressionType.GZIP : CompressionType.None,
+                true, null, false);
     }
 
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param stream             stream with reads
-     * @param format             read quality encoding format, if {@code guessQualityFormat} is true this value is used
-     *                           as default format
-     * @param ct                 type of compression (NONE, GZIP, etc)
-     * @param notFilteredOnly    outputs only reads that are not marked by 'filtered' flag in their header
-     * @param guessQualityFormat if true Reader will try to guess quality string format, if guess fails {@code format}
-     *                           will be used as quality string format
+     * @param file file with reads
+     * @param ct   type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(InputStream stream, QualityStringFormat format, CompressionType ct, boolean notFilteredOnly,
-                        boolean guessQualityFormat) throws IOException {
-        //Check for null
-        if (stream == null)
-            throw new NullPointerException();
-
-        if (stream instanceof FileInputStream)
-            totalSize = ((FileInputStream) stream).getChannel().size();
-        else
-            totalSize = 0L;
-
-        if (notFilteredOnly)
-            infoProvider = IlluminaInfoProviderFactory.createProvider(format);
-        else
-            infoProvider = null;
-
-        //Initialization
-        InputStream is = this.countingStream = new CountingInputStream(stream);
-
-        //Wrapping stream if UnCompression needed
-        is = ct.createInputStream(is);
-
-        //Creating main reder
-        this.reader = new BufferedReader(new InputStreamReader(is));
-
-        if (guessQualityFormat) {
-            reader.mark(8192);
-            QualityStringFormat f = QualityFormatGuesser.guessFormat(reader, 5500);
-            if (f != null)
-                format = f;
-
-            reader.reset();
-        }
-
-        if (format == null)
-            if (guessQualityFormat)
-                throw new RuntimeException("Format guess failed...");
-            else
-                throw new NullPointerException();
-
-        this.format = format;
+    public SFastqReader(String file, CompressionType ct) throws IOException {
+        this(new FileInputStream(file), null, ct, true, null, false);
     }
 
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param stream stream with reads
+     * @param file   file with reads
      * @param format read quality encoding format
      * @param ct     type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(InputStream stream, QualityStringFormat format, CompressionType ct) throws IOException {
-        this(stream, format, ct, false);
+    public SFastqReader(String file, QualityFormat format, CompressionType ct) throws IOException {
+        this(new FileInputStream(file), format, ct, false, null, false);
+    }
+
+    /**
+     * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
+     *
+     * @param file file with reads
+     * @throws IOException in case there is problem with reading from files
+     */
+    public SFastqReader(File file) throws IOException {
+        this(new FileInputStream(file), null, file.getName().endsWith(".gz") ? CompressionType.GZIP : CompressionType.None,
+                true, null, false);
     }
 
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param file            file with reads
-     * @param format          read quality encoding format
-     * @param ct              type of compression (NONE, GZIP, etc)
-     * @param notFilteredOnly outputs only reads that are not marked by 'filtered' flag in their header
+     * @param file file with reads
+     * @param ct   type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(File file, QualityStringFormat format, CompressionType ct, boolean notFilteredOnly) throws IOException {
-        this(new FileInputStream(file), format, ct, notFilteredOnly);
+    public SFastqReader(File file, CompressionType ct) throws IOException {
+        this(new FileInputStream(file), null, ct, true, null, false);
     }
 
     /**
@@ -160,66 +123,91 @@
      * @param ct     type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(File file, QualityStringFormat format, CompressionType ct) throws IOException {
-        this(new FileInputStream(file), format, ct, false);
+    public SFastqReader(File file, QualityFormat format, CompressionType ct) throws IOException {
+        this(new FileInputStream(file), format, ct, false, null, false);
     }
 
-
-    /*public SFastqReader(File file, QualityStringFormat format, CompressionType ct) throws FileNotFoundException {
-        //Check for null
-        if (file == null || format == null)
-            throw new NullPointerException();
-
-        //Initialization
-        InputStream is = new FileInputStream(file);
-        //this.channel = ((FileInputStream) is).getChannel();
-        this.format = format;
-
-        //Wrapping stream if UnCompression needed
-        try {
-            is = ct.createInputStream(is);
-        } catch (IOException e) {
-            throw new RuntimeException(e);
-        }
-
-        //Creating main reder
-        this.reader = new BufferedReader(new InputStreamReader(is));
-    }*/
-
-    //Additional constructors
-
     /**
-     * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
+     * Creates a {@link SSequencingRead} stream from a FASTQ stream with single-end reads data
      *
-     * @param fileName name of file containing reads
-     * @param format   read quality encoding format
+     * @param stream stream with reads
+     * @param ct     type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(String fileName, QualityStringFormat format) throws IOException {
-        this(fileName, format, CompressionType.None);
+    public SFastqReader(InputStream stream, CompressionType ct) throws IOException {
+        this(stream, null, ct, true, null, false);
     }
 
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param fileName name of file containing reads
-     * @param format   read quality encoding format
-     * @param ct       type of compression (NONE, GZIP, etc)
+     * @param stream stream with reads
+     * @param format read quality encoding format
+     * @param ct     type of compression (NONE, GZIP, etc)
      * @throws IOException in case there is problem with reading from files
      */
-    public SFastqReader(String fileName, QualityStringFormat format, CompressionType ct) throws IOException {
-        this(new File(fileName), format, ct);
+    public SFastqReader(InputStream stream, QualityFormat format, CompressionType ct) throws IOException {
+        this(stream, format, ct, false, null, false);
     }
 
+    //Root constructor
+
     /**
      * Creates a {@link SSequencingRead} stream from a FASTQ files with single-end read data
      *
-     * @param file   file with reads
-     * @param format read quality encoding format
-     * @throws IOException in case there is problem with reading from files
+     * @param stream             stream with reads
+     * @param format             read quality encoding format, if {@code guessQualityFormat} is true this value is used
+     *                           as a default format
+     * @param ct                 type of compression (NONE, GZIP, etc)
+     * @param guessQualityFormat if true reader will try to guess quality string format, if guess fails {@code format}
+     *                           will be used as a default quality string format, if {@code format==null} exception will
+     *                           be thrown
+     * @param infoProvider       read info provider
+     * @param notFilteredOnly    outputs only reads that are not marked by 'filtered' flag in their header
+     * @throws IOException
      */
-    public SFastqReader(File file, QualityStringFormat format) throws IOException {
-        this(file, format, CompressionType.None);
+    public SFastqReader(InputStream stream, QualityFormat format, CompressionType ct,
+                        boolean guessQualityFormat, ReadInfoProvider infoProvider, boolean notFilteredOnly) throws IOException {
+        //Check for null
+        if (stream == null)
+            throw new NullPointerException();
+
+        if (stream instanceof FileInputStream)
+            totalSize = ((FileInputStream) stream).getChannel().size();
+        else
+            totalSize = -1L;
+
+        this.infoProvider = infoProvider;
+        if (infoProvider == null && notFilteredOnly)
+            throw new IllegalArgumentException("Read info provider should be provided for filtering.");
+
+        //Initialization
+        InputStream is = this.countingStream = new CountingInputStream(stream);
+
+        //Wrapping stream if un-compression needed
+        is = ct.createInputStream(is);
+
+        //Creating main reder
+        this.reader = new BufferedReader(new InputStreamReader(is), BUFFER_SIZE);
+
+        //Guessing quality format
+        if (guessQualityFormat) {
+            reader.mark(BUFFER_SIZE);
+            QualityFormat f = QualityFormatChecker.guessFormat(reader, BUFFER_SIZE - 3072); //Buffer minus ~ one read.
+
+            if (f != null)
+                format = f;
+
+            reader.reset();
+        }
+
+        if (format == null)
+            if (guessQualityFormat)
+                throw new RuntimeException("Format guess failed.");
+            else
+                throw new NullPointerException();
+
+        this.format = format;
     }
 
     @Override
@@ -253,7 +241,7 @@
             read = parse(format, lines, id);
 
             if (infoProvider != null) {
-                IlluminaReadInfo info = infoProvider.getInfo(read.getDescription());
+                ReadInfo info = infoProvider.getInfo(read.getDescription());
 
                 if (info.isFiltered())
                     continue;
@@ -263,7 +251,7 @@
         }
     }
 
-    public static SSequencingRead parse(QualityStringFormat format, String[] lines, long id) {
+    public static SSequencingRead parse(QualityFormat format, String[] lines, long id) {
         String descriptionLine = lines[0];
 
         //Parsing:
@@ -286,37 +274,33 @@
             throw new RuntimeException("Wrong file format");
 
         //Creating quality
-        SequenceQuality quality;
-        try {
-            quality = format.getQualityFactory().create(qualityString.getBytes());
-        } catch (WrongQualityStringException ex) {
-            throw new RuntimeException("Error while parsing quality", ex);
-        }
-
         //Dot correction
         //if (sequenceLine.contains(".")
         //        || sequenceLine.contains("n")
         //        || sequenceLine.contains("N")) {
 
+        byte[] qualityValues;
+        try {
+            qualityValues = SequenceQualityPhred.parse(format, qualityString.getBytes(), true);
+        } catch (WrongQualityStringException ex) {
+            throw new RuntimeException("Error while parsing quality", ex);
+        }
+
         char[] seqChars = sequenceLine.toCharArray();
         for (int i = 0; i < seqChars.length; ++i)
             if (seqChars[i] == '.' || seqChars[i] == 'n' || seqChars[i] == 'N') {
                 //Substituting '.'/'n'/'N' with A
                 seqChars[i] = 'A';
                 //and setting bad quality to this nucleotide
-                quality.setRawQualityValue(i, format.getZeroQualityValue());
-                //increment corresponding counter
-                //dotCorrections.incrementAndGet();
+                qualityValues[i] = SequenceQualityUtils.BAD_QUALITY_VALUE;
             }
 
-        //    //Creating new sequence line
-        //    sequenceLine = new String(seqChars);
-        //}
+        SequenceQualityPhred quality = new SequenceQualityPhred(qualityValues);
 
         //Parsing sequence
         NucleotideSequence sequence;
         try {
-            sequence = NucleotideSequenceImpl.fromSequence(seqChars);
+            sequence = new NucleotideSequence(seqChars);
         } catch (RuntimeException re) {
             throw new RuntimeException("Error while parsing sequence.", re);
         }
@@ -325,13 +309,10 @@
         if (sequence.size() != quality.size())
             throw new RuntimeException("Wrong file format. Different sequence and quality sizes.");
 
-        //Refreshing redPrecent field for status update
-        //refreshRedPercent();
-
         return new SSequencingReadImpl(descriptionLine, new NucleotideSQPair(sequence, quality), id);
     }
 
-    public QualityStringFormat getQualityStringFormat() {
+    public QualityFormat getQualityFormat() {
         return format;
     }
 
@@ -351,6 +332,8 @@
 
     @Override
     public double getProgress() {
+        if (totalSize == -1L)
+            return Double.NaN;
         return ((double) countingStream.getBytesRead()) / totalSize;
     }
 
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqWriter.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqWriter.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqWriter.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SFastqWriter.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,7 +20,7 @@
  */
 package com.milaboratory.core.sequencing.io.fastq;
 
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
 import com.milaboratory.util.CompressionType;
 
@@ -37,7 +37,7 @@
     private static final byte[] PLUS_DELIMITER = "\n+\n".getBytes();
     //private FileOutputStream foStream;
     private final BufferedOutputStream bufferedOutputStream;
-    private final QualityStringFormat format;
+    private final QualityFormat format;
 
     /**
      * Creates file writer in FASTQ format for single-end reads
@@ -45,7 +45,7 @@
      * @param file   file to store reads
      * @param format sequencing quality format
      */
-    public SFastqWriter(String file, QualityStringFormat format) throws IOException {
+    public SFastqWriter(String file, QualityFormat format) throws IOException {
         this(new File(file), format, CompressionType.None);
     }
 
@@ -56,7 +56,7 @@
      * @param format sequencing quality format
      * @param ct     compression type to use
      */
-    public SFastqWriter(String file, QualityStringFormat format, CompressionType ct) throws IOException {
+    public SFastqWriter(String file, QualityFormat format, CompressionType ct) throws IOException {
         this(new File(file), format, ct);
     }
 
@@ -66,7 +66,7 @@
      * @param file   file to store reads
      * @param format sequencing quality format
      */
-    public SFastqWriter(File file, QualityStringFormat format) throws IOException {
+    public SFastqWriter(File file, QualityFormat format) throws IOException {
         this(new FileOutputStream(file), format, CompressionType.None);
     }
 
@@ -77,7 +77,7 @@
      * @param format sequencing quality format
      * @param ct     compression type to use
      */
-    public SFastqWriter(File file, QualityStringFormat format, CompressionType ct) throws IOException {
+    public SFastqWriter(File file, QualityFormat format, CompressionType ct) throws IOException {
         this(new FileOutputStream(file), format, ct);
     }
 
@@ -87,7 +87,7 @@
      * @param outputStream stream for formatted output
      * @param format       sequencing quality format
      */
-    public SFastqWriter(OutputStream outputStream, QualityStringFormat format) throws IOException {
+    public SFastqWriter(OutputStream outputStream, QualityFormat format) throws IOException {
         this(outputStream, format, CompressionType.None);
     }
 
@@ -98,7 +98,7 @@
      * @param format       sequencing quality format
      * @param ct           compression type to use
      */
-    public SFastqWriter(OutputStream outputStream, QualityStringFormat format, CompressionType ct) throws IOException {
+    public SFastqWriter(OutputStream outputStream, QualityFormat format, CompressionType ct) throws IOException {
         this.format = format;
         bufferedOutputStream = new BufferedOutputStream(ct.createOutputStream(outputStream), 65536);
     }
@@ -118,13 +118,13 @@
         /* //Not optimized
         byte quality;
         for (int i = 0; i < read.getData().size(); ++i) {
-            quality = read.getData().getQuality().rawQualityValue(i);
-            if (!format.isUnSafe() && quality < format.getQualityCodeFrom() || quality > format.getQualityCodeTo())
+            quality = read.getData().getQuality().value(i);
+            if (!format.isUnSafe() && quality < format.getMinValue() || quality > format.getMinValue())
                 throw new RuntimeException("Incompatible format and quality value");
-            bufferedOutputStream.write(quality + format.getQualityCodeOffset());
+            bufferedOutputStream.write(quality + format.getOffset());
         }*/
 
-        bufferedOutputStream.write(read.getData().getQuality().encode(format.getQualityCodeOffset()));
+        bufferedOutputStream.write(read.getData().getQuality().encode(format.getOffset()));
 
         bufferedOutputStream.write('\n');
     }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SSequencingReadTrimmer.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SSequencingReadTrimmer.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/SSequencingReadTrimmer.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/SSequencingReadTrimmer.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,7 +22,7 @@
 package com.milaboratory.core.sequencing.io.fastq;
 
 import cc.redberry.pipe.Processor;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
 import com.milaboratory.core.sequencing.read.SSequencingReadImpl;
 
@@ -39,8 +39,8 @@
      *
      * @param format sequencing quality format
      */
-    public SSequencingReadTrimmer(QualityStringFormat format) {
-        this.trimmer = new NucleotideSQPairTrimmer(format);
+    public SSequencingReadTrimmer(QualityFormat format) {
+        this.trimmer = new NucleotideSQPairTrimmer((byte) 2);
     }
 
     @Override
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/AbstractSequenceQualityFactory.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/AbstractSequenceQualityFactory.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/AbstractSequenceQualityFactory.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/AbstractSequenceQualityFactory.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,60 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq.quality;
-
-abstract class AbstractSequenceQualityFactory implements SequenceQualityFactory {
-    protected int qualityCodeOffset;
-    protected int qualityCodeFrom;
-    protected int qualityCodeTo;
-    protected boolean lowerUnSafe;
-
-    public boolean isLowerUnSafe() {
-        return lowerUnSafe;
-    }
-
-    public void setLowerUnSafe(boolean lowerUnSafe) {
-        this.lowerUnSafe = lowerUnSafe;
-    }
-
-    public int getQualityCodeFrom() {
-        return qualityCodeFrom;
-    }
-
-    public void setQualityCodeFrom(int qualityCodeFrom) {
-        this.qualityCodeFrom = qualityCodeFrom;
-    }
-
-    public int getQualityCodeOffset() {
-        return qualityCodeOffset;
-    }
-
-    public void setQualityCodeOffset(int qualityCodeOffset) {
-        this.qualityCodeOffset = qualityCodeOffset;
-    }
-
-    public int getQualityCodeTo() {
-        return qualityCodeTo;
-    }
-
-    public void setQualityCodeTo(int qualityCodeTo) {
-        this.qualityCodeTo = qualityCodeTo;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/PhredSequenceQualityFactory.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/PhredSequenceQualityFactory.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/PhredSequenceQualityFactory.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/PhredSequenceQualityFactory.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,40 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq.quality;
-
-import com.milaboratory.core.sequence.SequenceQuality;
-import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
-
-class PhredSequenceQualityFactory extends AbstractSequenceQualityFactory {
-    public SequenceQuality create(byte[] data) {
-        for (int i = 0; i < data.length; i++) {
-            data[i] -= qualityCodeOffset;
-            if (data[i] > qualityCodeTo)
-                throw new WrongQualityStringException(((char) (data[i] + qualityCodeOffset)) + " [" + data[i] + "]");
-            if (data[i] < qualityCodeFrom)
-                if (!lowerUnSafe)
-                    throw new WrongQualityStringException(((char) (data[i] + qualityCodeOffset)) + " [" + data[i] + "]");
-                else
-                    data[i] = (byte) qualityCodeFrom;
-        }
-        return new SequenceQualityPhred(data);
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/QualityStringFormat.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/QualityStringFormat.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/QualityStringFormat.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/QualityStringFormat.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,107 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq.quality;
-
-/**
- * A base class to store various sequencing quality formats
- */
-public enum QualityStringFormat {
-    Sanger((byte) 33, (byte) 0, (byte) 40, false, new PhredSequenceQualityFactory(), "Sanger", "sanger"),
-    //Solexa((byte) 64, (byte) -5, (byte) 40, false, new SolexaSequenceQualityFactory(), "Illumina 1.2 or less", "illumina12"),
-    Illumina13((byte) 64, (byte) 0, (byte) 40, false, new PhredSequenceQualityFactory(), "Illumina 1.3+", "illumina13"),
-    Illumina15((byte) 64, (byte) 2, (byte) 40, true, new PhredSequenceQualityFactory(), "Illumina 1.5+", "illumina15"),
-    Illumina18((byte) 33, (byte) 2, (byte) 45, true, new PhredSequenceQualityFactory(), "Illumina [Casava 1.8]", "illumina18"),
-    Illumina18u((byte) 33, (byte) 2, (byte) 45, true, new PhredSequenceQualityFactory(), "Illumina Unsafe [Casava 1.8]", "illumina18u", true);
-    private byte qualityCodeOffset;
-    private byte qualityCodeFrom;
-    private byte qualityCodeTo;
-    private byte zeroQualityValue;
-    private boolean zeroFlanked, isUnSafe;
-    private SequenceQualityFactory qualityFactory;
-    private String name, xmlRepresentation;
-
-    private QualityStringFormat(byte qualityCodeOffset, byte qualityCodeFrom, byte qualityCodeTo, boolean zeroFlanked, AbstractSequenceQualityFactory qualityFactory, String name,
-                                String xmlRepresentation) {
-        this.qualityCodeOffset = qualityCodeOffset;
-        this.qualityCodeFrom = qualityCodeFrom;
-        this.qualityCodeTo = qualityCodeTo;
-        this.zeroQualityValue = qualityCodeFrom;
-        this.zeroFlanked = zeroFlanked;
-        this.xmlRepresentation = xmlRepresentation;
-        qualityFactory.setQualityCodeFrom(qualityCodeFrom);
-        qualityFactory.setQualityCodeOffset(qualityCodeOffset);
-        qualityFactory.setQualityCodeTo(qualityCodeTo);
-        this.qualityFactory = qualityFactory;
-        this.name = name;
-        this.isUnSafe = true;
-    }
-
-    private QualityStringFormat(byte qualityCodeOffset, byte qualityCodeFrom, byte qualityCodeTo, boolean zeroFlanked, AbstractSequenceQualityFactory qualityFactory, String name,
-                                String xmlRepresentation, boolean unSafe) {
-        this(qualityCodeOffset, qualityCodeFrom, qualityCodeTo, zeroFlanked, qualityFactory, name, xmlRepresentation);
-        qualityFactory.setLowerUnSafe(unSafe);
-        this.isUnSafe = unSafe;
-    }
-
-    public byte getQualityCodeFrom() {
-        return qualityCodeFrom;
-    }
-
-    public byte getQualityCodeOffset() {
-        return qualityCodeOffset;
-    }
-
-    public byte getQualityCodeTo() {
-        return qualityCodeTo;
-    }
-
-    public SequenceQualityFactory getQualityFactory() {
-        return qualityFactory;
-    }
-
-    public boolean isZeroFlanked() {
-        return zeroFlanked;
-    }
-
-    public byte getZeroQualityValue() {
-        return zeroQualityValue;
-    }
-
-    public String getXmlRepresentation() {
-        return xmlRepresentation;
-    }
-
-    public boolean isUnSafe() {
-        return isUnSafe;
-    }
-
-    public static QualityStringFormat fromXML(String xml) {
-        for (QualityStringFormat format : values())
-            if (format.xmlRepresentation.equals(xml))
-                return format;
-        return null;
-    }
-
-    @Override
-    public String toString() {
-        return name;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/SequenceQualityFactory.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/SequenceQualityFactory.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/SequenceQualityFactory.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/SequenceQualityFactory.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,32 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq.quality;
-
-import com.milaboratory.core.sequence.SequenceQuality;
-
-/**
- * Sequence quality factory from byte array.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- */
-public interface SequenceQualityFactory {
-    SequenceQuality create(byte[] data);
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/WrongQualityStringException.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/WrongQualityStringException.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/WrongQualityStringException.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/fastq/quality/WrongQualityStringException.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,30 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.io.fastq.quality;
-
-public class WrongQualityStringException extends RuntimeException {
-    public WrongQualityStringException() {
-    }
-
-    public WrongQualityStringException(String message) {
-        super(message);
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFClipper.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFClipper.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFClipper.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFClipper.java	2013-10-09 08:03:10.000000000 +0000
@@ -40,7 +40,7 @@
         int[] flowgramIndexes = new int[to - from];
         System.arraycopy(input.getSequenceFlowgramMappping(),
                 from, flowgramIndexes, 0, to - from);
-        NucleotideSQPair clippedSQPair = input.getData().getSubPairCopy(from, to).getDeepCopy();
+        NucleotideSQPair clippedSQPair = input.getData().getRange(from, to);
         //last element in this array. (input.getData().size() == input.getSequenceFlowgramMappping().length)
         int fFrom = 0, fTo = input.getSequenceFlowgramMappping()[input.getData().size() - 1];
         if (from > 0)
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFHeader.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFHeader.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFHeader.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFHeader.java	2013-10-09 08:03:10.000000000 +0000
@@ -21,7 +21,6 @@
 package com.milaboratory.core.sequencing.io.sff;
 
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 
 /**
  * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
@@ -48,7 +47,7 @@
         this.numberOfFlows = numberOfFlows;
         this.flowChars = flowChars;
         this.keySequence = keySequence;
-        this.flowsSequence = NucleotideSequenceImpl.fromSequence(flowChars);
+        this.flowsSequence = new NucleotideSequence(flowChars);
     }
 
     public char[] getFlowChars() {
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFReader.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFReader.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFReader.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/io/sff/SFFReader.java	2013-10-09 08:03:10.000000000 +0000
@@ -24,7 +24,6 @@
 import com.milaboratory.core.sequence.NucleotideSQPair;
 import com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet;
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.core.sequence.quality.SequenceQualityPhred;
 import com.milaboratory.core.sequencing.io.SSequencingDataReaderWithFlowgram;
 import com.milaboratory.core.sequencing.read.SSequencingReadWithFlowgram;
@@ -167,7 +166,7 @@
         for (int i = 0; i < numberOfBases; ++i)
             sequenceData.set(i, NucleotideAlphabet.INSTANCE.codeFromSymbol((char) (buff[2 * header.getNumberOfFlows() + numberOfBases + i])));
         byte[] qualityData = new byte[numberOfBases];
-        NucleotideSequence sequence = NucleotideSequenceImpl.fromStorage(sequenceData);
+        NucleotideSequence sequence = new NucleotideSequence(sequenceData);
         System.arraycopy(buff, 2 * header.getNumberOfFlows() + 2 * numberOfBases, qualityData, 0, numberOfBases);
         NucleotideSQPair sqData = new NucleotideSQPair(sequence, new SequenceQualityPhred(qualityData));
         int[] flowgramIndexes = new int[numberOfBases];
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotif.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotif.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotif.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotif.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,171 +0,0 @@
-package com.milaboratory.core.sequencing.motif;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-
-import java.util.BitSet;
-
-/**
- * Implementation of simplest nucleotide sequence motif.
- *
- * @author Bolotin Dmitriy <bolotin.dmitriy@gmail.com>
- */
-public final class NucleotideMotif {
-    private final BitSet data;
-    private final int size;
-
-    /**
-     * Inner private constructor for reverseComplement motif
-     *
-     * @param data
-     */
-    private NucleotideMotif(BitSet data, int size) {
-        this.data = data;
-        this.size = size;
-    }
-
-    /**
-     * Creates motif from it's String representation.
-     *
-     * @param motif
-     */
-    public NucleotideMotif(String motif) {
-        this.data = new BitSet(motif.length() << 2);
-        for (int i = 0; i < motif.length(); ++i) {
-            byte[] codes = NucleotideWildcards.getCodes(motif.charAt(i));
-            if (codes == null)
-                throw new RuntimeException("Illegal nucleotide/wildcard: \"" + motif.charAt(i) + "\".");
-            for (byte b : codes)
-                data.set(b + (i << 2));
-        }
-        this.size = motif.length();
-    }
-
-    /**
-     * Size of motif.
-     *
-     * @return
-     */
-    public final int size() {
-        return size;
-    }
-
-    /**
-     * Return true if motif matches sub-sequence of nucleotide sequence from (from) inclusive to (from + size())
-     * exclusive.
-     *
-     * @param sequence target sequence
-     * @param from     offset to start matching
-     * @return
-     */
-    public final boolean matches(NucleotideSequence sequence, int from) {
-        if (from < 0 || from >= sequence.size())
-            throw new IllegalArgumentException();
-        if (sequence.size() < from + size())
-            return false;
-        for (int i = 0; i < size; ++i)
-            if (!data.get(sequence.codeAt(from + i) + (i << 2)))
-                return false;
-        return true;
-    }
-
-    /**
-     * Return number of mismatches between motif and sub-sequence of nucleotide
-     * sequence from (from) inclusive to (from + size()) exclusive.
-     *
-     * @param sequence target sequence
-     * @param from offset to start matching
-     * @return
-     */
-    /*public final int mismatchCount(NucleotideSequence sequence, int from) {
-        if (from < 0 || from >= sequence.size())
-            throw new IllegalArgumentException();
-        if (sequence.size() < from + size())
-            return -1;
-        for (int i = 0; i < size; ++i)
-            if (!data.get(sequence.codeAt(from + i) + (i << 2)))
-                return false;
-        return true;
-    }*/
-
-
-    /**
-     * Return reverse-complement motif.
-     */
-    public final NucleotideMotif reverseComplement() {
-        BitSet newStore = new BitSet(data.size());
-        for (int i = 0; i < data.size(); ++i)
-            if (data.get(data.size() - 1 - i))
-                newStore.set(i);
-        return new NucleotideMotif(newStore, size);
-    }
-
-    /**
-     * Try to find this motif in sub-sequence.
-     *
-     * @param sequence target sequence
-     * @param from     left subsequence border; inclusive
-     * @param to       right subsequence border; exclusive
-     * @return coordinate of first match (coordinate of first nucleotide in the match) or -1 if no matches found
-     */
-    public final int findMatch(NucleotideSequence sequence, int from, int to) {
-        if (from < 0 || from >= sequence.size() || to < 0
-                || to > sequence.size()
-                || from > to)
-            throw new IllegalArgumentException();
-        to -= size;
-        for (int i = from; i < to; ++i)
-            if (matches(sequence, i))
-                return i;
-        return -1;
-    }
-
-    /**
-     * Try to find this motif in sequence.
-     *
-     * @param sequence target sequence
-     * @return coordinate of first match (coordinate of first nucleotide in the match) or -1 if no matches found
-     */
-    public final int findMatch(NucleotideSequence sequence) {
-        return findMatch(sequence, 0, sequence.size());
-    }
-
-    /**
-     * Direct motif querying method. Returns true if nucleotide with specified code is allowed on the specified
-     * position.
-     *
-     * @param position position in the motif
-     * @param code     nucleotide code (1..3)
-     * @return
-     */
-    public final boolean get(int position, byte code) {
-        return data.get(code + (position << 2));
-    }
-
-    public String toString() {
-        char[] chars = new char[size];
-        int offset;
-        for (int i = 0; i < size; ++i) {
-            offset = i << 2;
-            chars[i] = NucleotideWildcards.getSymbol(data.get(offset), data.get(offset + 1),
-                    data.get(offset + 2), data.get(offset + 3));
-        }
-        return new String(chars);
-    }
-
-    @Override
-    public boolean equals(Object o) {
-        if (this == o) return true;
-        if (o == null || getClass() != o.getClass()) return false;
-
-        NucleotideMotif that = (NucleotideMotif) o;
-
-        if (!data.equals(that.data)) return false;
-
-        return true;
-    }
-
-    @Override
-    public int hashCode() {
-        return data.hashCode();
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearch.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearch.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearch.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearch.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,24 +0,0 @@
-package com.milaboratory.core.sequencing.motif;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-
-public class NucleotideMotifSearch {
-    private final NucleotideMotif motif;
-    private final NucleotideMotifSearchOptions options;
-    private final int exactRegionFrom, exactRegionTo;
-
-    public NucleotideMotifSearch(NucleotideMotif motif, NucleotideMotifSearchOptions options, int exactRegionFrom, int exactRegionTo) {
-        this.motif = motif;
-        this.options = options;
-        this.exactRegionFrom = exactRegionFrom;
-        this.exactRegionTo = exactRegionTo;
-    }
-
-//    public int nextMatch(int from, NucleotideSequence sequence) {
-//        if (exactRegionFrom >= 0) { //If exact region exists
-//            for (int i = 0; i < sequence.size(); ++i) {
-//
-//            }
-//        }
-//    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearchOptions.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearchOptions.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearchOptions.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideMotifSearchOptions.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,17 +0,0 @@
-package com.milaboratory.core.sequencing.motif;
-
-public class NucleotideMotifSearchOptions {
-    public static NucleotideMotifSearchOptions NORMAL_WITH_TRUNCATION = new NucleotideMotifSearchOptions(2, 1, 1, 2, 2);
-    public static NucleotideMotifSearchOptions NORMAL_WITHOUT_TRUNCATION = new NucleotideMotifSearchOptions(2, 1, 1, 2, 0);
-
-    public final int maxMismatches, maxDeletions, maxInsertions, maxTotalErrors;
-    public final int maxLeftTruncation;
-
-    public NucleotideMotifSearchOptions(int maxMismatches, int maxDeletions, int maxInsertions, int maxTotalErrors, int maxLeftTruncation) {
-        this.maxMismatches = maxMismatches;
-        this.maxDeletions = maxDeletions;
-        this.maxInsertions = maxInsertions;
-        this.maxTotalErrors = maxTotalErrors;
-        this.maxLeftTruncation = maxLeftTruncation;
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideWildcards.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideWildcards.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideWildcards.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/motif/NucleotideWildcards.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,125 +0,0 @@
-package com.milaboratory.core.sequencing.motif;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet;
-
-import java.util.Arrays;
-import java.util.Comparator;
-import java.util.HashMap;
-import java.util.Map;
-
-import static com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet.*;
-
-/**
- * Implementation of standard IUPAC notations.<br/><br/> See <a href="http://users.ox.ac.uk/~linc1775/blueprint.htm">http://users.ox.ac.uk/~linc1775/blueprint.htm</a>.
- *
- * @author Bolotin Dmitriy <bolotin.dmitriy@gmail.com>
- */
-public class NucleotideWildcards {
-    private static final char[] CHARS;
-    private static final Wildcard[] WILDCARDS;
-    private static final Map<Byte, Wildcard> pCodeToWildcard = new HashMap<>();
-
-    static {
-        WILDCARDS = new Wildcard[]{
-                //No nucleotide
-                new Wildcard('-'),
-                //Exact nucleotides
-                new Wildcard('A', 'A'),
-                new Wildcard('G', 'G'),
-                new Wildcard('C', 'C'),
-                new Wildcard('T', 'T'),
-                //Two-letter wildcard
-                new Wildcard('R', 'A', 'G'),
-                new Wildcard('Y', 'C', 'T'),
-                new Wildcard('S', 'G', 'C'),
-                new Wildcard('W', 'A', 'T'),
-                new Wildcard('K', 'G', 'T'),
-                new Wildcard('M', 'A', 'C'),
-                //Three-letter wildcards
-                new Wildcard('B', 'C', 'G', 'T'),
-                new Wildcard('D', 'A', 'G', 'T'),
-                new Wildcard('H', 'A', 'C', 'T'),
-                new Wildcard('V', 'A', 'C', 'G'),
-                //Any nucleotide
-                new Wildcard('N', 'A', 'C', 'G', 'T')
-        };
-
-        //Sorting to make binary search possible
-        Arrays.sort(WILDCARDS, new Comparator<Wildcard>() {
-            @Override
-            public int compare(Wildcard o1, Wildcard o2) {
-                return Character.compare(o1.character, o2.character);
-            }
-        });
-
-        //Creating projections
-        CHARS = new char[WILDCARDS.length];
-        for (int i = 0; i < CHARS.length; ++i) {
-            CHARS[i] = WILDCARDS[i].character;
-            pCodeToWildcard.put(WILDCARDS[i].pCode, WILDCARDS[i]);
-        }
-    }
-
-    /**
-     * Returns sorted byte array with codes corresponding to specified symbol.<br/><br/>
-     * <p/>
-     * Allowed symbols: -, A, T, G, C, R, Y, S, W, K, M, B, D, H, V, N<br/><br/>
-     * <p/>
-     * IUPAC standard notion used. For more information see <a href="http://users.ox.ac.uk/~linc1775/blueprint.htm">http://users.ox.ac.uk/~linc1775/blueprint.htm</a>.
-     *
-     * @param symbol
-     * @return
-     */
-    public static byte[] getCodes(char symbol) {
-        char upper = Character.toUpperCase(symbol);
-        int position = Arrays.binarySearch(CHARS, upper);
-        if (position < 0)
-            return null;
-        return WILDCARDS[position].to;
-    }
-
-    /**
-     * Returns wildcard symbol for specified nucleotides.<br/><br/>
-     * <p/>
-     * IUPAC standard notion used. For more information see <a href="http://users.ox.ac.uk/~linc1775/blueprint.htm">http://users.ox.ac.uk/~linc1775/blueprint.htm</a>.
-     *
-     * @param a allow A
-     * @param g allow G
-     * @param c allow C
-     * @param t allow T
-     * @return
-     */
-    public static char getSymbol(boolean a, boolean g, boolean c, boolean t) {
-        byte pCode = 0;
-
-        if (a)
-            pCode |= 1 << A;
-        if (g)
-            pCode |= 1 << G;
-        if (c)
-            pCode |= 1 << C;
-        if (t)
-            pCode |= 1 << T;
-
-        Wildcard wc = pCodeToWildcard.get(pCode);
-        if (wc == null)
-            throw new RuntimeException("Impossible exception. (Assertion fail)");
-        return wc.character;
-    }
-
-    private static class Wildcard {
-        public final char character;
-        public final byte[] to;
-        public final byte pCode;
-
-        public Wildcard(char character, char... to) {
-            this.character = character;
-            this.to = new byte[to.length];
-            byte pCode = 0;
-            for (int i = 0; i < to.length; ++i)
-                pCode |= 1 << (this.to[i] = NucleotideAlphabet.INSTANCE.codeFromSymbol(to[i]));
-            Arrays.sort(this.to);
-            this.pCode = pCode;
-        }
-    }
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/read/PDataSerRecord.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/read/PDataSerRecord.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/read/PDataSerRecord.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/read/PDataSerRecord.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,48 +0,0 @@
-/*
- * MiTCR <http://milaboratory.com>
- *
- * Copyright (c) 2010-2013:
- *     Bolotin Dmitriy     <bolotin.dmitriy@gmail.com>
- *     Chudakov Dmitriy    <chudakovdm@mail.ru>
- *
- * MiTCR is free software: you can redistribute it and/or modify it
- * under the terms of the GNU General Public License as published by the Free
- * Software Foundation, either version 3 of the License, or (at your option)
- * any later version.
- *
- * This program is distributed in the hope that it will be useful, but WITHOUT
- * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
- * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for
- * more details.
- *
- * You should have received a copy of the GNU General Public License along
- * with this program. If not, see <http://www.gnu.org/licenses/>.
- */
-package com.milaboratory.core.sequencing.read;
-
-import com.milaboratory.core.sequence.NucleotideSQPair;
-
-/**
- * Interface for paired sequencing read.
- *
- * @author Bolotin Dmitriy (bolotin.dmitriy@gmail.com)
- * @author Shugay Mikhail (mikhail.shugay@gmail.com)
- */
-public interface PDataSerRecord extends SequencingRead {
-    /**
-     * Retrieves one read form paired read
-     *
-     * @param idInPair 0 or 1
-     * @return single read
-     */
-    SSequencingRead getSRecord(int idInPair);
-
-    /**
-     * Retrieves data form paired read
-     *
-     * @param idInPair 0 or 1
-     * @return single read
-     */
-    NucleotideSQPair getData(int idInPair);
-
-}
diff -Nru micommons-0.9/src/main/java/com/milaboratory/core/sequencing/read/PSequencingRead.java micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/read/PSequencingRead.java
--- micommons-0.9/src/main/java/com/milaboratory/core/sequencing/read/PSequencingRead.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/core/sequencing/read/PSequencingRead.java	2013-10-09 08:03:10.000000000 +0000
@@ -44,5 +44,4 @@
      * @return single read
      */
     NucleotideSQPair getData(int idInPair);
-
 }
diff -Nru micommons-0.9/src/main/java/com/milaboratory/util/Bit2Array.java micommons-1.0.3/src/main/java/com/milaboratory/util/Bit2Array.java
--- micommons-0.9/src/main/java/com/milaboratory/util/Bit2Array.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/main/java/com/milaboratory/util/Bit2Array.java	2013-10-09 08:03:10.000000000 +0000
@@ -90,6 +90,19 @@
         return true;
     }
 
+    //TODO optimize
+    public Bit2Array getRange(int from, int to) {
+        if (from < 0 || (from >= size && size != 0)
+                || to < from || to > size)
+            throw new IndexOutOfBoundsException();
+
+        Bit2Array ret = new Bit2Array(to - from);
+        int i = 0;
+        for (int j = from; j < to; ++j, ++i)
+            ret.set(i, get(j));
+        return ret;
+    }
+
     /*public static Bit2Array wrap(byte[] data, int size) {
         return new Bit2Array(size, data);
     }*/
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifSearchAdvancedTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifSearchAdvancedTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifSearchAdvancedTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifSearchAdvancedTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -24,7 +24,7 @@
 package com.milaboratory.core.sequence.motif;
 
 import com.milaboratory.core.sequence.SequencingErrorType;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
+import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
 import org.junit.Test;
 
 import static org.junit.Assert.assertEquals;
@@ -43,14 +43,14 @@
 
     @Test
     public void mmExactTest01() {
-        int result = search.search(NucleotideSequenceImpl.fromSequence(s0),
+        int result = search.search(new NucleotideSequence(s0),
                 LowQualityIndicator.Utils.wrap(q0));
         assertEquals(result, 3);
     }
 
     @Test
     public void mmComparisonTest01() {
-        int result = search.search(NucleotideSequenceImpl.fromSequence(s0),
+        int result = search.search(new NucleotideSequence(s0),
                 LowQualityIndicator.Utils.wrap(q0),
                 23, s0.length());
         assertEquals(result, 26);
@@ -64,7 +64,7 @@
 
     @Test
     public void mmComparisonTest02() {
-        int result = search.search(NucleotideSequenceImpl.fromSequence(s1),
+        int result = search.search(new NucleotideSequence(s1),
                 LowQualityIndicator.Utils.wrap(q1));
         assertEquals(result, 52);
     }
@@ -77,7 +77,7 @@
 
     @Test
     public void mmComparisonTest03() {
-        int result = search.search(NucleotideSequenceImpl.fromSequence(s2),
+        int result = search.search(new NucleotideSequence(s2),
                 LowQualityIndicator.Utils.wrap(q2));
         assertEquals(result, 3);
     }
@@ -91,7 +91,7 @@
     @Test
     public void mmFalseTest01() {
         //Focused on exact match rejection
-        int result = search.search(NucleotideSequenceImpl.fromSequence(sf0),
+        int result = search.search(new NucleotideSequence(sf0),
                 LowQualityIndicator.Utils.wrap(qf0),
                 0, 25);
         assertEquals(result, -1);
@@ -99,7 +99,7 @@
 
     @Test
     public void mmFalseTest02() {
-        int result = search.search(NucleotideSequenceImpl.fromSequence(sf0),
+        int result = search.search(new NucleotideSequence(sf0),
                 LowQualityIndicator.Utils.wrap(qf0));
         assertEquals(result, -1);
     }
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/motif/NucleotideMotifTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,7 +20,7 @@
  */
 package com.milaboratory.core.sequence.motif;
 
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
+import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
 import org.junit.Test;
 
 import static org.junit.Assert.*;
@@ -32,24 +32,24 @@
     @Test
     public void testMatches01() {
         NucleotideMotif nm = new NucleotideMotif("ATCG");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("ATCG"), 0));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("ACCG"), 0));
+        assertTrue(nm.matches(new NucleotideSequence("ATCG"), 0));
+        assertFalse(nm.matches(new NucleotideSequence("ACCG"), 0));
     }
 
     @Test
     public void testMatches02() {
         NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGGGGT"), 0));
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGTGGT"), 0));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGCGGT"), 0));
+        assertTrue(nm.matches(new NucleotideSequence("GAGGAGACGGTGACCGGGGT"), 0));
+        assertTrue(nm.matches(new NucleotideSequence("GAGGAGACGGTGACCGTGGT"), 0));
+        assertFalse(nm.matches(new NucleotideSequence("GAGGAGACGGTGACCGCGGT"), 0));
     }
 
     @Test
     public void testMatches03() {
         NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GACAGAGGAGACGGTGACCGGGGTAA"), 4));
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("CAGATGAGGAGACGGTGACCGTGGTGG"), 5));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("CCAGAGGAGACGGTGACCGCGGTG"), 3));
+        assertTrue(nm.matches(new NucleotideSequence("GACAGAGGAGACGGTGACCGGGGTAA"), 4));
+        assertTrue(nm.matches(new NucleotideSequence("CAGATGAGGAGACGGTGACCGTGGTGG"), 5));
+        assertFalse(nm.matches(new NucleotideSequence("CCAGAGGAGACGGTGACCGCGGTG"), 3));
     }
 
     @Test
@@ -61,14 +61,15 @@
     @Test
     public void rcTest() {
         NucleotideMotif nm = new NucleotideMotif("ATGC");
+        System.out.println(nm.reverseComplement());
         assertTrue(nm.reverseComplement().equals(new NucleotideMotif("GCAT")));
     }
 
     @Test
     public void testFindMatch01() {
         NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("GACAGAGGAGACGGTGACCGGGGTAA")), 4);
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("CAGATGAGGAGACGGTGACCGTGGTGG")), 5);
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("CCAGAGGAGACGGTGACCGCGGTG")), -1);
+        assertEquals(nm.findMatch(new NucleotideSequence("GACAGAGGAGACGGTGACCGGGGTAA")), 4);
+        assertEquals(nm.findMatch(new NucleotideSequence("CAGATGAGGAGACGGTGACCGTGGTGG")), 5);
+        assertEquals(nm.findMatch(new NucleotideSequence("CCAGAGGAGACGGTGACCGCGGTG")), -1);
     }
 }
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregatorTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregatorTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregatorTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequenceAggregatorTest.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,17 +0,0 @@
-package com.milaboratory.core.sequence.nucleotide;
-
-import org.junit.Test;
-
-import static com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl.fromSequence;
-
-public class NucleotideSequenceAggregatorTest {
-    @Test
-    public void test1() throws Exception {
-        NucleotideSequenceAggregator aggr = new NucleotideSequenceAggregator(8, 2);
-        aggr.putSequence(fromSequence("attacaca"));
-        aggr.putSequence(fromSequence("tattacac"));
-        aggr.putSequence(fromSequence("tattacaa"));
-
-        System.out.println(aggr.getSequence(.5));
-    }
-}
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequencesTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequencesTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequencesTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/NucleotideSequencesTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,22 +20,21 @@
  */
 package com.milaboratory.core.sequence.nucleotide;
 
-import com.milaboratory.core.sequence.util.NucleotideSubSequence;
 import org.junit.Assert;
 import org.junit.Test;
 
 public class NucleotideSequencesTest {
     @Test
     public void test1() {
-        NucleotideSequence sequence = NucleotideSequenceImpl.fromSequence("ATTAGACATAGACA");
+        NucleotideSequence sequence = new NucleotideSequence("ATTAGACATAGACA");
         Assert.assertEquals(sequence.toString(), "ATTAGACATAGACA");
-        NucleotideSequence subSequence = new NucleotideSubSequence(sequence, 0, sequence.size());
+        NucleotideSequence subSequence = sequence.getRange(0, sequence.size());
         Assert.assertEquals(subSequence.toString(), "ATTAGACATAGACA");
         Assert.assertEquals(subSequence.hashCode(), sequence.hashCode());
         Assert.assertEquals(subSequence, sequence);
 
-        NucleotideSequence sequence1 = NucleotideSequenceImpl.fromSequence("AGACATAGACA");
-        NucleotideSequence subSequence1 = new NucleotideSubSequence(sequence, 3);
+        NucleotideSequence sequence1 = new NucleotideSequence("AGACATAGACA");
+        NucleotideSequence subSequence1 = sequence.getRange(3, sequence.size());
 
         Assert.assertEquals(subSequence1.hashCode(), sequence1.hashCode());
         Assert.assertEquals(subSequence1, sequence1);
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/ReverseComplementTransformerTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/ReverseComplementTransformerTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/nucleotide/ReverseComplementTransformerTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/nucleotide/ReverseComplementTransformerTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,7 +20,6 @@
  */
 package com.milaboratory.core.sequence.nucleotide;
 
-import com.milaboratory.core.sequence.util.NucleotideRCSequence;
 import org.junit.Test;
 
 import static org.hamcrest.CoreMatchers.not;
@@ -30,9 +29,9 @@
 public class ReverseComplementTransformerTest {
     @Test
     public void test1() {
-        NucleotideSequence ns = NucleotideSequenceImpl.fromSequence("atagagaattagataaggcagatacgatcgacgtgtactactagcta");
-        NucleotideSequence rc = new NucleotideRCSequence(ns);
-        NucleotideSequence rcrc = new NucleotideRCSequence(rc);
+        NucleotideSequence ns = new NucleotideSequence("atagagaattagataaggcagatacgatcgacgtgtactactagcta");
+        NucleotideSequence rc = ns.getReverseComplement();
+        NucleotideSequence rcrc = rc.getReverseComplement();
         assertEquals(rcrc, ns);
         assertEquals(rcrc.hashCode(), ns.hashCode());
         assertThat(rc, not(ns));
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/tree/SequenceTreeMapTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/tree/SequenceTreeMapTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/tree/SequenceTreeMapTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/tree/SequenceTreeMapTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -8,7 +8,6 @@
 import com.milaboratory.core.sequence.aminoacid.CDRAminoAcidSequence;
 import com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet;
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.util.Bit2Array;
 import org.apache.commons.math.random.RandomGenerator;
 import org.apache.commons.math.random.Well19937a;
@@ -16,7 +15,6 @@
 
 import java.util.*;
 
-import static com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl.fromSequence;
 import static com.milaboratory.core.sequence.util.SequencesUtils.cat;
 import static org.hamcrest.CoreMatchers.not;
 import static org.junit.Assert.*;
@@ -45,16 +43,16 @@
     public void testExact1() throws Exception {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
-        assertNull(map.put(fromSequence("attagaca"), 1));
-        assertEquals((Integer) 1, map.put(fromSequence("attagaca"), 2));
+        assertNull(map.put(new NucleotideSequence("attagaca"), 1));
+        assertEquals((Integer) 1, map.put(new NucleotideSequence("attagaca"), 2));
 
-        assertNull(map.put(fromSequence("attacaca"), 3));
+        assertNull(map.put(new NucleotideSequence("attacaca"), 3));
 
-        assertEquals((Integer) 3, map.get(fromSequence("attacaca")));
+        assertEquals((Integer) 3, map.get(new NucleotideSequence("attacaca")));
 
         Set<NucleotideSequence> sequences = new HashSet<>();
-        sequences.add(fromSequence("attacaca"));
-        sequences.add(fromSequence("attagaca"));
+        sequences.add(new NucleotideSequence("attacaca"));
+        sequences.add(new NucleotideSequence("attagaca"));
 
         Set<Integer> ints = new HashSet<>();
         ints.add(2);
@@ -78,17 +76,17 @@
         Set<NucleotideSequence> sequences = new HashSet<>();
         Set<Integer> ints = new HashSet<>();
 
-        assertNull(map.put(fromSequence("attacacaattaattacacacacaattacaca"), 3));
-        sequences.add(fromSequence("attacacaattaattacacacacaattacaca"));
+        assertNull(map.put(new NucleotideSequence("attacacaattaattacacacacaattacaca"), 3));
+        sequences.add(new NucleotideSequence("attacacaattaattacacacacaattacaca"));
         ints.add(3);
-        assertNull(map.put(fromSequence("attacacaattacacaattacgacacttacaca"), 4));
-        sequences.add(fromSequence("attacacaattacacaattacgacacttacaca"));
+        assertNull(map.put(new NucleotideSequence("attacacaattacacaattacgacacttacaca"), 4));
+        sequences.add(new NucleotideSequence("attacacaattacacaattacgacacttacaca"));
         ints.add(4);
-        assertNull(map.put(fromSequence("atattattacacaacacatacattacacaaca"), 5));
-        sequences.add(fromSequence("atattattacacaacacatacattacacaaca"));
+        assertNull(map.put(new NucleotideSequence("atattattacacaacacatacattacacaaca"), 5));
+        sequences.add(new NucleotideSequence("atattattacacaacacatacattacacaaca"));
         ints.add(5);
-        assertNull(map.put(fromSequence("attacacaattacacaattacacaattacacaattacacaattacaca"), 19));
-        sequences.add(fromSequence("attacacaattacacaattacacaattacacaattacacaattacaca"));
+        assertNull(map.put(new NucleotideSequence("attacacaattacacaattacacaattacacaattacacaattacaca"), 19));
+        sequences.add(new NucleotideSequence("attacacaattacacaattacacaattacacaattacacaattacaca"));
         ints.add(19);
 
         SequenceTreeMap.Node node;
@@ -110,27 +108,27 @@
     public void testBranchingEnumerator1() {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
-        assertNull(map.put(fromSequence("attagaca"), 1)); // 1 mm
-        assertNull(map.put(fromSequence("attacaca"), 2)); // match
-        assertNull(map.put(fromSequence("ataacaca"), 3)); // 1 mm
-        assertNull(map.put(fromSequence("attcgtca"), 4)); // many mm
-        assertNull(map.put(fromSequence("atttacaca"), 5)); // 1 insertion in stretch
-        assertNull(map.put(fromSequence("atacaca"), 6)); // 1 deletion in the "t" stretch
-        assertNull(map.put(fromSequence("attacacta"), 7)); // 1 insertion
-        assertNull(map.put(fromSequence("attcaca"), 8)); // 1 deletion
-        assertNull(map.put(fromSequence("attacac"), 9)); // 1 deletion in the end
-        assertNull(map.put(fromSequence("ttacaca"), 10)); // 1 deletion in the beginning
-        assertNull(map.put(fromSequence("tattacaca"), 11)); // 1 insertion in the beginning
-        assertNull(map.put(fromSequence("attacacat"), 12)); // 1 insertion in the ent
-        assertNull(map.put(fromSequence("attacact"), 13)); // 1 mm end
-        assertNull(map.put(fromSequence("tttacaca"), 14)); // 1 mm begin
+        assertNull(map.put(new NucleotideSequence("attagaca"), 1)); // 1 mm
+        assertNull(map.put(new NucleotideSequence("attacaca"), 2)); // match
+        assertNull(map.put(new NucleotideSequence("ataacaca"), 3)); // 1 mm
+        assertNull(map.put(new NucleotideSequence("attcgtca"), 4)); // many mm
+        assertNull(map.put(new NucleotideSequence("atttacaca"), 5)); // 1 insertion in stretch
+        assertNull(map.put(new NucleotideSequence("atacaca"), 6)); // 1 deletion in the "t" stretch
+        assertNull(map.put(new NucleotideSequence("attacacta"), 7)); // 1 insertion
+        assertNull(map.put(new NucleotideSequence("attcaca"), 8)); // 1 deletion
+        assertNull(map.put(new NucleotideSequence("attacac"), 9)); // 1 deletion in the end
+        assertNull(map.put(new NucleotideSequence("ttacaca"), 10)); // 1 deletion in the beginning
+        assertNull(map.put(new NucleotideSequence("tattacaca"), 11)); // 1 insertion in the beginning
+        assertNull(map.put(new NucleotideSequence("attacacat"), 12)); // 1 insertion in the ent
+        assertNull(map.put(new NucleotideSequence("attacact"), 13)); // 1 mm end
+        assertNull(map.put(new NucleotideSequence("tttacaca"), 14)); // 1 mm begin
 
         HashSet<Integer>[] asserts = new HashSet[3];
         asserts[0] = new HashSet<>(Arrays.asList(1, 3, 13, 14));
         asserts[1] = new HashSet<>(Arrays.asList(6, 8, 9, 10));
         asserts[2] = new HashSet<>(Arrays.asList(5, 7, 11, 12));
 
-        NucleotideSequence reference = fromSequence("attacaca");
+        NucleotideSequence reference = new NucleotideSequence("attacaca");
 
         for (byte mode = 0; mode < 3; ++mode) {
 
@@ -162,22 +160,22 @@
     public void testNIterator() throws Exception {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
-        assertNull(map.put(fromSequence("attagaca"), 1)); // 1 mm
-        assertNull(map.put(fromSequence("attacaca"), 2)); // match
-        assertNull(map.put(fromSequence("ataacaca"), 3)); // 1 mm
-        assertNull(map.put(fromSequence("attcgtca"), 4)); // many mm
-        assertNull(map.put(fromSequence("atttacaca"), 5)); // 1 insertion in stretch
-        assertNull(map.put(fromSequence("atacaca"), 6)); // 1 deletion in the "t" stretch
-        assertNull(map.put(fromSequence("attacacta"), 7)); // 1 insertion
-        assertNull(map.put(fromSequence("attcaca"), 8)); // 1 deletion
-        assertNull(map.put(fromSequence("attacac"), 9)); // 1 deletion in the end
-        assertNull(map.put(fromSequence("ttacaca"), 10)); // 1 deletion in the beginning
-        assertNull(map.put(fromSequence("tattacaca"), 11)); // 1 insertion in the beginning
-        assertNull(map.put(fromSequence("attacacat"), 12)); // 1 insertion in the ent
-        assertNull(map.put(fromSequence("attacact"), 13)); // 1 mm end
-        assertNull(map.put(fromSequence("tttacaca"), 14)); // 1 mm begin
+        assertNull(map.put(new NucleotideSequence("attagaca"), 1)); // 1 mm
+        assertNull(map.put(new NucleotideSequence("attacaca"), 2)); // match
+        assertNull(map.put(new NucleotideSequence("ataacaca"), 3)); // 1 mm
+        assertNull(map.put(new NucleotideSequence("attcgtca"), 4)); // many mm
+        assertNull(map.put(new NucleotideSequence("atttacaca"), 5)); // 1 insertion in stretch
+        assertNull(map.put(new NucleotideSequence("atacaca"), 6)); // 1 deletion in the "t" stretch
+        assertNull(map.put(new NucleotideSequence("attacacta"), 7)); // 1 insertion
+        assertNull(map.put(new NucleotideSequence("attcaca"), 8)); // 1 deletion
+        assertNull(map.put(new NucleotideSequence("attacac"), 9)); // 1 deletion in the end
+        assertNull(map.put(new NucleotideSequence("ttacaca"), 10)); // 1 deletion in the beginning
+        assertNull(map.put(new NucleotideSequence("tattacaca"), 11)); // 1 insertion in the beginning
+        assertNull(map.put(new NucleotideSequence("attacacat"), 12)); // 1 insertion in the ent
+        assertNull(map.put(new NucleotideSequence("attacact"), 13)); // 1 mm end
+        assertNull(map.put(new NucleotideSequence("tttacaca"), 14)); // 1 mm begin
 
-        NucleotideSequence reference = fromSequence("attacaca");
+        NucleotideSequence reference = new NucleotideSequence("attacaca");
 
         SequenceTreeMap.Node<Integer> node;
 
@@ -216,8 +214,8 @@
 
     @Test
     public void testEdge1() throws Exception {
-        NucleotideSequence sequence1 = fromSequence("CTG"),
-                sequence2 = fromSequence("C");
+        NucleotideSequence sequence1 = new NucleotideSequence("CTG"),
+                sequence2 = new NucleotideSequence("C");
 
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
@@ -234,8 +232,8 @@
 
     @Test
     public void testEdge2() throws Exception {
-        NucleotideSequence sequence1 = fromSequence("CTG"),
-                sequence2 = fromSequence("CGT");
+        NucleotideSequence sequence1 = new NucleotideSequence("CTG"),
+                sequence2 = new NucleotideSequence("CGT");
 
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
@@ -252,8 +250,8 @@
 
     @Test
     public void testEdge3() throws Exception {
-        NucleotideSequence sequence1 = fromSequence("C"),
-                sequence2 = fromSequence("CTG");
+        NucleotideSequence sequence1 = new NucleotideSequence("C"),
+                sequence2 = new NucleotideSequence("CTG");
 
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
 
@@ -275,9 +273,9 @@
     @Test
     public void testGuideDel() throws Exception {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
-        map.put(fromSequence("attacacaattaattacacacacaattacaca"), 3);
+        map.put(new NucleotideSequence("attacacaattaattacacacacaattacaca"), 3);
 
-        Sequence sequence = fromSequence("attacacaattaatttacacacacaattacaca");
+        Sequence sequence = new NucleotideSequence("attacacaattaatttacacacacaattacaca");
 
         SequenceTreeMap.NeighborhoodIterator<Integer> neighborhoodIterator =
                 map.getNeighborhoodIterator(sequence, 0.2,
@@ -307,10 +305,10 @@
     @Test
     public void testGuideMM() throws Exception {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
-        map.put(fromSequence("attacacaattaattacacacacaattacaca"), 3);
-        //map.put(fromSequence("attacacaattaatttacacacacaattacaca"), 4);
+        map.put(new NucleotideSequence("attacacaattaattacacacacaattacaca"), 3);
+        //map.put(new NucleotideSequence("attacacaattaatttacacacacaattacaca"), 4);
 
-        Sequence sequence = fromSequence("attacacaattaataacacacacaattacaca");
+        Sequence sequence = new NucleotideSequence("attacacaattaataacacacacaattacaca");
 
         SequenceTreeMap.NeighborhoodIterator<Integer> neighborhoodIterator =
                 map.getNeighborhoodIterator(sequence, 0.2,
@@ -340,10 +338,10 @@
     @Test
     public void testGuideIns() throws Exception {
         SequenceTreeMap<NucleotideSequence, Integer> map = new SequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
-        map.put(fromSequence("attacacaattaattacacacacaattacaca"), 3);
-        //map.put(fromSequence("attacacaattaatttacacacacaattacaca"), 4);
+        map.put(new NucleotideSequence("attacacaattaattacacacacaattacaca"), 3);
+        //map.put(new NucleotideSequence("attacacaattaatttacacacacaattacaca"), 4);
 
-        Sequence sequence = fromSequence("attacacaattaatacacacacaattacaca");
+        Sequence sequence = new NucleotideSequence("attacacaattaatacacacacaattacaca");
 
         SequenceTreeMap.NeighborhoodIterator<Integer> neighborhoodIterator =
                 map.getNeighborhoodIterator(sequence, 0.2,
@@ -439,7 +437,7 @@
      * Utility functions and their tests
      */
     private Sequence getRandomSequence(Alphabet alphabet, int length) {
-        SequenceBuilder builder = alphabet.getSequenceBuilderFactory().create(length);
+        SequenceBuilder builder = alphabet.getBuilderFactory().create(length);
         for (int i = 0; i < length; ++i)
             builder.setCode(i, (byte) random.nextInt(alphabet.codesCount()));
         return builder.create();
@@ -450,7 +448,7 @@
         int position, i;
         switch (type) {
             case -1: //Copy
-                builder = sequence.getAlphabet().getSequenceBuilderFactory().create(sequence.size());
+                builder = sequence.getAlphabet().getBuilderFactory().create(sequence.size());
                 for (i = 0; i < builder.size(); ++i)
                     builder.setCode(i, sequence.codeAt(i));
                 return builder.create();
@@ -458,7 +456,7 @@
             case 0: //Mismatch
                 if (sequence.getAlphabet() == NucleotideAlphabet.INSTANCE)
                     return introduceNucleotideMismatch((NucleotideSequence) sequence);
-                builder = sequence.getAlphabet().getSequenceBuilderFactory().create(sequence.size());
+                builder = sequence.getAlphabet().getBuilderFactory().create(sequence.size());
                 for (i = 0; i < builder.size(); ++i)
                     builder.setCode(i, sequence.codeAt(i));
                 position = random.nextInt(sequence.size());
@@ -467,7 +465,7 @@
                 return builder.create();
 
             case 1: //Deletion
-                builder = sequence.getAlphabet().getSequenceBuilderFactory().create(sequence.size() - 1);
+                builder = sequence.getAlphabet().getBuilderFactory().create(sequence.size() - 1);
                 position = random.nextInt(sequence.size());
                 for (i = 0; i < position; ++i)
                     builder.setCode(i, sequence.codeAt(i));
@@ -477,7 +475,7 @@
                 return builder.create();
 
             case 2: //Insertion
-                builder = sequence.getAlphabet().getSequenceBuilderFactory().create(sequence.size() + 1);
+                builder = sequence.getAlphabet().getBuilderFactory().create(sequence.size() + 1);
                 position = random.nextInt(sequence.size() + 1);
                 for (i = 0; i < position; ++i)
                     builder.setCode(i, sequence.codeAt(i));
@@ -492,10 +490,10 @@
     }
 
     private NucleotideSequence introduceNucleotideMismatch(NucleotideSequence sequence) {
-        final Bit2Array storage = NucleotideSequenceImpl.storageFromSequence(sequence);
+        final Bit2Array storage = sequence.getInnerData();
         int position = random.nextInt(storage.size());
         storage.set(position, 0x3 & (storage.get(position) + 1 + random.nextInt(3)));
-        return NucleotideSequenceImpl.fromStorage(storage);
+        return new NucleotideSequence(storage);
     }
 
     final static Alphabet[] alphabets = {NucleotideAlphabet.INSTANCE, AminoAcidAlphabet.INSTANCE, CDRAminoAcidAlphabet.INSTANCE};
@@ -789,24 +787,24 @@
     //public void testPosition() throws Exception {
     //    NSTa map = new NSTa();
     //
-    //    //assertNull(map.put(fromSequence("attagaca"))); // 1 mm
-    //    //assertNull(map.put(fromSequence("attacaca"))); // match
-    //    //assertNull(map.put(fromSequence("ataacaca"))); // 1 mm
-    //    //assertNull(map.put(fromSequence("attcgtca"))); // many mm
-    //    //assertNull(map.put(fromSequence("atttacaca"))); // 1 insertion in stretch
-    //    //assertNull(map.put(fromSequence("atacaca"))); // 1 deletion in the "t" stretch
-    //    //assertNull(map.put(fromSequence("attacacga"))); // 1 insertion
-    //    //assertNull(map.put(fromSequence("attcaca"))); // 1 deletion
-    //    //assertNull(map.put(fromSequence("attacac"))); // 1 deletion in the end
-    //    //assertNull(map.put(fromSequence("ttacaca"))); // 1 deletion in the beginning
-    //    //assertNull(map.put(fromSequence("tattacaca"))); // 1 insertion in the beginning
-    //    //assertNull(map.put(fromSequence("attacacat"))); // 1 insertion in the ent
-    //    assertNull(map.put(fromSequence("attacagt"))); // 1 mm end
-    //    //assertNull(map.put(fromSequence("attacaca"))); // 1 mm end
-    //    //assertNull(map.put(fromSequence("tttacaca"))); // 1 mm begin
-    //    //assertNull(map.put(fromSequence("cttagaca"))); // 2 mm begin
+    //    //assertNull(map.put(new NucleotideSequence("attagaca"))); // 1 mm
+    //    //assertNull(map.put(new NucleotideSequence("attacaca"))); // match
+    //    //assertNull(map.put(new NucleotideSequence("ataacaca"))); // 1 mm
+    //    //assertNull(map.put(new NucleotideSequence("attcgtca"))); // many mm
+    //    //assertNull(map.put(new NucleotideSequence("atttacaca"))); // 1 insertion in stretch
+    //    //assertNull(map.put(new NucleotideSequence("atacaca"))); // 1 deletion in the "t" stretch
+    //    //assertNull(map.put(new NucleotideSequence("attacacga"))); // 1 insertion
+    //    //assertNull(map.put(new NucleotideSequence("attcaca"))); // 1 deletion
+    //    //assertNull(map.put(new NucleotideSequence("attacac"))); // 1 deletion in the end
+    //    //assertNull(map.put(new NucleotideSequence("ttacaca"))); // 1 deletion in the beginning
+    //    //assertNull(map.put(new NucleotideSequence("tattacaca"))); // 1 insertion in the beginning
+    //    //assertNull(map.put(new NucleotideSequence("attacacat"))); // 1 insertion in the ent
+    //    assertNull(map.put(new NucleotideSequence("attacagt"))); // 1 mm end
+    //    //assertNull(map.put(new NucleotideSequence("attacaca"))); // 1 mm end
+    //    //assertNull(map.put(new NucleotideSequence("tttacaca"))); // 1 mm begin
+    //    //assertNull(map.put(new NucleotideSequence("cttagaca"))); // 2 mm begin
     //
-    //    NucleotideSequence reference = fromSequence("attacaga");
+    //    NucleotideSequence reference = new NucleotideSequence("attacaga");
     //
     //    SequenceTreeMap.NeighborhoodIterator<NucleotideSequence> ni = map.getNeighborhoodIterator(reference, 2, 1, 1, 2);
     //
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMapTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMapTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMapTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/tree/TSSequenceTreeMapTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -22,7 +22,6 @@
 
 import com.milaboratory.core.sequence.nucleotide.NucleotideAlphabet;
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
 import com.milaboratory.core.sequence.util.NucleotideSequenceGenerator;
 import com.milaboratory.util.Factory;
 import org.junit.Test;
@@ -38,8 +37,8 @@
 public class TSSequenceTreeMapTest {
     @Test
     public void simpleTest() {
-        NucleotideSequence sequence1 = NucleotideSequenceImpl.fromSequence("ATTAGACA");
-        NucleotideSequence sequence2 = NucleotideSequenceImpl.fromSequence("ATTATACA");
+        NucleotideSequence sequence1 = new NucleotideSequence("ATTAGACA");
+        NucleotideSequence sequence2 = new NucleotideSequence("ATTATACA");
         Integer i1 = 1;
         Integer i2 = 2;
         TSSequenceTreeMap<NucleotideSequence, Integer> map = new TSSequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
@@ -51,8 +50,8 @@
 
     @Test
     public void simpleIterationTest() {
-        NucleotideSequence sequence1 = NucleotideSequenceImpl.fromSequence("ATTAGACA");
-        NucleotideSequence sequence2 = NucleotideSequenceImpl.fromSequence("ATTATACA");
+        NucleotideSequence sequence1 = new NucleotideSequence("ATTAGACA");
+        NucleotideSequence sequence2 = new NucleotideSequence("ATTATACA");
         Integer i1 = 1;
         Integer i2 = 2;
         TSSequenceTreeMap<NucleotideSequence, Integer> map = new TSSequenceTreeMap<>(NucleotideAlphabet.INSTANCE);
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregatorTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregatorTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregatorTest.java	1970-01-01 00:00:00.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/util/NucleotideSequenceAggregatorTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -0,0 +1,16 @@
+package com.milaboratory.core.sequence.util;
+
+import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
+import org.junit.Test;
+
+public class NucleotideSequenceAggregatorTest {
+    @Test
+    public void test1() throws Exception {
+        NucleotideSequenceAggregator aggr = new NucleotideSequenceAggregator(8, 2);
+        aggr.putSequence(new NucleotideSequence("attacaca"));
+        aggr.putSequence(new NucleotideSequence("tattacac"));
+        aggr.putSequence(new NucleotideSequence("tattacaa"));
+
+        System.out.println(aggr.getSequence(.5));
+    }
+}
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequence/util/SequencesUtilsTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/util/SequencesUtilsTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequence/util/SequencesUtilsTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequence/util/SequencesUtilsTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -3,7 +3,6 @@
 import com.milaboratory.core.sequence.nucleotide.NucleotideSequence;
 import org.junit.Test;
 
-import static com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl.fromSequence;
 import static com.milaboratory.core.sequence.util.SequencesUtils.cat;
 import static org.junit.Assert.assertEquals;
 
@@ -12,9 +11,9 @@
     public void testCat() throws Exception {
         String seq1s = "gttacagc",
                 seq2s = "gctatacgatgc";
-        NucleotideSequence seq1 = fromSequence(seq1s),
-                seq2 = fromSequence(seq2s),
-                catAssert = fromSequence(seq1s + seq2s);
+        NucleotideSequence seq1 = new NucleotideSequence(seq1s),
+                seq2 = new NucleotideSequence(seq2s),
+                catAssert = new NucleotideSequence(seq1s + seq2s);
 
         assertEquals(catAssert, cat(seq1, seq2));
         assertEquals(catAssert.hashCode(), cat(seq1, seq2).hashCode()); //Just in case
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequencing/io/fastq/PFastqReaderTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/io/fastq/PFastqReaderTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequencing/io/fastq/PFastqReaderTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/io/fastq/PFastqReaderTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,8 +20,8 @@
  */
 package com.milaboratory.core.sequencing.io.fastq;
 
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.io.PSequencingDataReader;
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
 import com.milaboratory.core.sequencing.read.PSequencingRead;
 import com.milaboratory.util.CompressionType;
 import org.junit.Assert;
@@ -36,7 +36,8 @@
     public void test0() throws URISyntaxException, IOException {
         File sampleR1 = new File(ClassLoader.getSystemResource("sample_r1.fastq").toURI());
         File sampleR2 = new File(ClassLoader.getSystemResource("sample_r2.fastq").toURI());
-        PSequencingDataReader reader = new PFastqReader(sampleR1, sampleR2, QualityStringFormat.Illumina18, CompressionType.None, true, true);
+        PSequencingDataReader reader = new PFastqReader(sampleR1, sampleR2, QualityFormat.Phred33, CompressionType.None,
+                new Casava18InfoProvider(), true, true);
         PSequencingRead read;
         int count = 0;
         while ((read = reader.take()) != null) {
@@ -49,7 +50,8 @@
     public void test1() throws URISyntaxException, IOException {
         File sampleR1 = new File(ClassLoader.getSystemResource("sample_r1.fastq").toURI());
         File sampleR2 = new File(ClassLoader.getSystemResource("sample_r2.fastq").toURI());
-        PSequencingDataReader reader = new PFastqReader(sampleR1, sampleR2, QualityStringFormat.Illumina18, CompressionType.None, true, false);
+        PSequencingDataReader reader = new PFastqReader(sampleR1, sampleR2, QualityFormat.Phred33, CompressionType.None,
+                new Casava18InfoProvider(), true, false);
         PSequencingRead read;
         int count = 0;
         while ((read = reader.take()) != null) {
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequencing/io/fastq/SFastqReaderTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/io/fastq/SFastqReaderTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequencing/io/fastq/SFastqReaderTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/io/fastq/SFastqReaderTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -20,7 +20,7 @@
  */
 package com.milaboratory.core.sequencing.io.fastq;
 
-import com.milaboratory.core.sequencing.io.fastq.quality.QualityStringFormat;
+import com.milaboratory.core.sequence.quality.QualityFormat;
 import com.milaboratory.core.sequencing.read.SSequencingRead;
 import com.milaboratory.util.CompressionType;
 import org.junit.Assert;
@@ -36,8 +36,8 @@
     public void test1() throws URISyntaxException, IOException {
         File sample = new File(ClassLoader.getSystemResource("sample_r1.fastq").toURI());
         File sampleGz = new File(ClassLoader.getSystemResource("sample_r1.fastq.gz").toURI());
-        SFastqReader reader = new SFastqReader(sample, QualityStringFormat.Illumina18, CompressionType.None, false);
-        SFastqReader readerGz = new SFastqReader(sampleGz, QualityStringFormat.Illumina18, CompressionType.GZIP, false);
+        SFastqReader reader = new SFastqReader(sample, QualityFormat.Phred33, CompressionType.None);
+        SFastqReader readerGz = new SFastqReader(sampleGz, QualityFormat.Phred33, CompressionType.GZIP);
         SSequencingRead read;
         while ((read = reader.take()) != null)
             Assert.assertEquals(read.getData().getSequence(), readerGz.take().getData().getSequence());
@@ -51,14 +51,14 @@
     @Test
     public void testGuess1() throws Exception {
         String[] files = {"solexa1.fastq.gz", "solexa2.fastq.gz", "solexa3.fastq.gz", "sample_r1.fastq.gz", "sample_r2.fastq.gz"};
-        QualityStringFormat formats[] = {QualityStringFormat.Illumina15, QualityStringFormat.Illumina15, QualityStringFormat.Illumina15,
-                QualityStringFormat.Illumina18u, QualityStringFormat.Illumina18u};
+        QualityFormat formats[] = {QualityFormat.Phred64, QualityFormat.Phred64, QualityFormat.Phred64,
+                QualityFormat.Phred33, QualityFormat.Phred33};
         int reads[] = {10, 10, 10, 10, 10};
 
         for (int i = 0; i < files.length; ++i) {
             InputStream stream = ClassLoader.getSystemResource(files[i]).openStream();
-            SFastqReader reader = new SFastqReader(stream, null, CompressionType.GZIP, false, true);
-            Assert.assertEquals(formats[i], reader.getQualityStringFormat());
+            SFastqReader reader = new SFastqReader(stream, CompressionType.GZIP);
+            Assert.assertEquals(formats[i], reader.getQualityFormat());
             int n = 0;
             while (reader.take() != null)
                 ++n;
diff -Nru micommons-0.9/src/test/java/com/milaboratory/core/sequencing/motif/NucleotideMotifTest.java micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/motif/NucleotideMotifTest.java
--- micommons-0.9/src/test/java/com/milaboratory/core/sequencing/motif/NucleotideMotifTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/core/sequencing/motif/NucleotideMotifTest.java	1970-01-01 00:00:00.000000000 +0000
@@ -1,56 +0,0 @@
-package com.milaboratory.core.sequencing.motif;
-
-import com.milaboratory.core.sequence.nucleotide.NucleotideSequenceImpl;
-import org.junit.Ignore;
-import org.junit.Test;
-
-import static org.junit.Assert.*;
-
-/**
- * @author Bolotin Dmitriy <bolotin.dmitriy@gmail.com>
- */
-public class NucleotideMotifTest {
-    @Test
-    public void testMatches01() {
-        NucleotideMotif nm = new NucleotideMotif("ATCG");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("ATCG"), 0));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("ACCG"), 0));
-    }
-
-    @Test
-    public void testMatches02() {
-        NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGGGGT"), 0));
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGTGGT"), 0));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("GAGGAGACGGTGACCGCGGT"), 0));
-    }
-
-    @Test
-    public void testMatches03() {
-        NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("GACAGAGGAGACGGTGACCGGGGTAA"), 4));
-        assertTrue(nm.matches(NucleotideSequenceImpl.fromSequence("CAGATGAGGAGACGGTGACCGTGGTGG"), 5));
-        assertFalse(nm.matches(NucleotideSequenceImpl.fromSequence("CCAGAGGAGACGGTGACCGCGGTG"), 3));
-    }
-
-    @Test
-    public void testToString01() {
-        NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertEquals(nm.toString(), "GAGGAGACGGTGACCRKGGT");
-    }
-
-    @Test
-    @Ignore
-    public void rcTest() {
-        NucleotideMotif nm = new NucleotideMotif("ATGC");
-        assertTrue(nm.reverseComplement().equals(new NucleotideMotif("GCAT")));
-    }
-
-    @Test
-    public void testFindMatch01() {
-        NucleotideMotif nm = new NucleotideMotif("GAGGAGACGGTGACCRKGGT");
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("GACAGAGGAGACGGTGACCGGGGTAA")), 4);
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("CAGATGAGGAGACGGTGACCGTGGTGG")), 5);
-        assertEquals(nm.findMatch(NucleotideSequenceImpl.fromSequence("CCAGAGGAGACGGTGACCGCGGTG")), -1);
-    }
-}
diff -Nru micommons-0.9/src/test/java/com/milaboratory/util/Bit2ArrayTest.java micommons-1.0.3/src/test/java/com/milaboratory/util/Bit2ArrayTest.java
--- micommons-0.9/src/test/java/com/milaboratory/util/Bit2ArrayTest.java	2013-08-12 11:21:58.000000000 +0000
+++ micommons-1.0.3/src/test/java/com/milaboratory/util/Bit2ArrayTest.java	2013-10-09 08:03:10.000000000 +0000
@@ -30,6 +30,7 @@
 import java.util.Random;
 
 import static org.junit.Assert.assertEquals;
+import static org.junit.Assert.assertTrue;
 
 /**
  * @author dmitriybolotin
@@ -46,6 +47,7 @@
                 values[i] = r.nextInt(4);
                 ba.set(i, values[i]);
             }
+            assertTrue(ba.equals(ba.getRange(0, ba.size())));
             //Testing
             for (int i = 0; i < length; ++i)
                 assertEquals(values[i], ba.get(i));
@@ -65,6 +67,7 @@
                 values[i] = r.nextInt(4);
                 ba.set(i, values[i]);
             }
+            assertTrue(ba.equals(ba.getRange(0, ba.size())));
             //Testing
             for (int i = 0; i < length; ++i)
                 assertEquals(values[i], ba.get(i));